Skip to main content

Full text of "Role of prostaglandins in the maturation and function of human monocyte derived dendritic cells"

See other formats


THE ROLE OF PROSTAGLANDINS IN THE MATURATION AND 
FUNCTION OF HUMAN MONOCYTE DERIVED DENDRITIC CELLS 



By 
DONNA S. WHITTAKER 



A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL 

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT 

OF THE REQUIREMENTS FOR THE DEGREE OF 

DOCTOR OF PHILOSOPHY 

UNIVERSITY OF FLORIDA 

2000 






ACKNOWLEDGMENTS 

First, I would like to recognize the Medical Service Corps, United States Army, 
that I proudly serve, for giving me the opportunity to fulfill a life long dream. Next, I 
would like to thank my mentor, Michael J. Clare-Salzer, M.D., for his encouragement 
and patience and for setting the bar high enough to challenge me but low enough to be 
attainable. Dr. Clare-Salzler is an intelligent, gifted scientist/teacher and I feel honored to 
have had the opportunity to work for him. Also, I would like to thank the members of my 
supervisory committee, Drs. Lyle Moldawer, Margaret Wallace, Ammon Peck and 
Maureen Goodenow, for their many hours of guidance and support through out this 
process. I am also appreciative of my laboratory mate, Keith Bahjat, and the other 
members of the Clare-Salzler Laboratory, Rena Bahjat, Dr. Vikas Dharnidharka, Dr. 
Sally Litherland and Dr. YiYu Li for all their suggestions and stimulating conversation 
about immunology, science, and life. 

Volunteer samples are vital to any human study. I would like to thank the 
Diabetes Prevention Trial participants; the clinical research nurses, Karen Fuller, Mary 
Alice Dennis, and Roberta Cook; and the many normal controls who contributed samples 
for this study. 

On a personal note, there are many people to whom I am grateful or indebted. 
First, my parents, Colonel (retired) William P. and Samille Sewell, who dragged me 
around the world, taught me to do my best and told me that I could be anything that I 



u 



wanted to be. I am forever thankful for their unconditional love and their never ending 
support of my endeavors. Next, I would like to thank the members of the 0430 running 
group, especially Dr. Sarah Martin, who listened to my complaints and helped me stay 
focused during these last four years. Next, I am deeply indebted and have eternal 
admiration, love and respect for my husband, Tom Steves, who gave up everything to be 
everything to me, taught me how to relax, but most importantly showed me that life is 
fun. Finally, to my children Garrett and Trevor, who cannot remember a time when their 
mom wasn't in school, I appreciate their love, support and understanding even though 
sometimes it was not convenient or easy. My hope is that they will benefit from this 
experience by gaining an appreciation for the joy and happiness associated with life-long 
learning. 



in 



TABLE OF CONTENTS 

page 

ACKNOWLEDGMENTS ii 

ABSTRACT iv 

CHAPTERS 

1 INTRODUCTION 1 

2 REVIEW OF LITERATURE 8 

Prostanglandins: Metabolism, Function and Receptors 8 

Eicosanoids 8 

Prostaglandin Biosynthesis 8 

Prostaglandin Receptors 11 

Dendritic Cells 14 

Initiators of Immune Response 14 

Interleukin-12 16 

Lineages of Dendritic Cells 17 

Polarizing Thl and Th2 Responses in Naive T Cells 19 

Effects of Prostaglandins on Maturation and Function 20 

Pathogenesis of Diabetes 21 

Prostaglandins and the Pathogenesis of IDD in Human and NOD 22 

3 AUTOREGULATION OF HUMAN MONOCYTE DERIVED DENDRITIC CELL 
MATURATION AND FUNCTION BY CYCLOOXYGENASE-2 MEDIATED 
PROSTAGLANDIN PRODUCTION 25 

Review of Literature 25 

Materials and Methods 26 

Isolation of Monocytes and Dendritic Cell Cultures 26 

Surface and Internal Protein Analysis 27 

PGE2 and Cytokine Assays 28 

Antigen Uptake Measured by FITC-Dextran and Lucifer Yellow 29 

Results 29 

MDC Express COX-1 and COX-2 29 

Prostanoid Production by I-MDC and M-MDC 33 

COX-2 Mediated Prostaglandin Synthesis Promotes MDC Maturation 37 

Endogenous Prostanoid Production Affects Secretion of IL-12 39 



iv 



IL-10 Production by MDC is not Regulated by Prostaglandin Synthesis 44 

Prostaglandins Do Not Significantly Affect Antigen Uptake 44 

Discussion 46 

4 MATURATION STIMULI AND MODULATION OF PROSTAGLANDIN 
RECEPTORS REGULATE THE EFFECTS OF PGE2 ON INTERLEUKIN-12 
PRODUCTION BY MONOCYTE DERIVED DENDRITIC CELLS 51 

Review of Literature 51 

Materials and Methods 53 

Materials 53 

Isolation of Monocytes and Dendritic Cell Cultures 53 

Isolation of Total RNA and Reverse Transcription 54 

Relative Polymerase Chain Reaction 55 

IL-12p40 and IL-12p70 Assays 55 

Measurement ofcAMP Formation 56 

Quantitation of 3 HPGE2 Binding on I- and M-MDC 56 

Results 57 

PGE2 Regulation IL-12 in I-MDC Through EP2 and EP4 Receptors 57 

EP2 Receptors Mediate the Suppressive Effects of PGE2 on IL-12p70 

Production by Maturing MDC 61 

Fully Mature MDC Express EP4 Receptors But IL-12 Production is 

Insensitive to the Regulatory Effects of PGE2 and cAMP 63 

Discussion 68 

5 GENERATION OF PHENOTYPICALLY AND FUNCTIONALLY NORMAL 
MONOCYTE DERIVED DENDRITIC CELLS FROM SUBJECTS AT HIGH RISK 
FOR AUTOIMMUNE INSULIN DEPENDENT DIABETES 72 

Review of Literature 72 

Materials and Methods 74 

Subjects 74 

Isolation of Monocytes and MDC Cultures 74 

Flow Cytometry for Surface and Internal Proteins 75 

Autologous and Allogeneic Mixed Lymphocyte Reaction (MLR) 76 

Measurement of IL-12 and Prostanoids 76 

Measurement of Endocytosis 77 

Statistical Analysis 77 

Results 77 

Discussion 86 

6 SUMMARY AND CONCLUSIONS 89 

REFERENCES 94 

BIOGRAPHICAL SKETCH 107 






Abstract of Dissertation Presented to the Graduate School 
of the University of Florida in Partial Fulfillment of the 
Requirements for the Degree of Doctor of Philosophy 

THE ROLE OF PROSTAGLANDINS IN THE MATURATION AND 
FUNCTION OF HUMAN MONOCYTE DERIVED DENDRITIC CELLS 



By 

Donna S. Whittaker 

August 2000 

Chairman: Michael J. Clare-Salzler, M.D. 

Major Department: Pathology, Immunology, and Laboratory Medicine 

Dendritic cells (DC) are important mediators of immunity and tolerance. 

Prostaglandins, especially prostaglandin E2 (PGE2), have diverse affects on the adaptive 

immune response including in vitro maturation and function of monocyte derived 

dendritic cells (MDC). Using an established protocol for generation of MDC, the role of 

prostaglandins in the maturation and function of MDC was investigated. This study 

demonstrates that MDC constitutively express cyclooxygenase-2 (COX-2) during 

differentiation from monocyte precursors and produce prostaglandins that autoregulate 

expression of CD83, a mature DC specific marker, and secretion of interleukin-12 (IL- 

12), a critical proinflammatory cytokine responsible for Thl immune responses. 

Interestingly, the effects of PGE2 are highly dependent on the maturation stage of the 

MDC. In immature-MDC (I -MDC), the presence of PGE2, whether endogenously 

produced or added to cultures, increases the secretion of IL-12 while in maturing MDC, 

vi 



PGE2 profoundly decreases the secretion of IL-12. PGE2 mediates its response in MDC 
through prostaglandin receptors EP2 and EP4, which are members of the G protein- 
coupled receptor family. EP2 and EP4 stimulate adenylate cyclase which increases 
cAMP in response to ligand binding. This study finds that I-MDC express mRNA for 
EP2 and EP4. As MDC mature, the expression of mRNA for EP2 gradually declines by 
50% at 24 hours and remains decreased after 48 hours while the mRNA for EP4 increases 
four fold at two hours and remains significantly increased in the fully mature MDC. 
Pharmacological agents that target specific prostaglandin receptors show that increases in 
IL-12 in the I-MDC are mediated through EP2 and EP4 and downregulation of IL-12 in 
the maturing MDC is mediated through EP2 and high cAMP production. Fully matured 
MDC produce lower levels of cAMP in response to PGE2, have fewer PGE2 binding 
sites, and are resistant to modulation of IL-12 by PGE2 as well as cAMP analogues. 
These findings have important implications for the development of the MDC for 
immunotherapy as well as the effects of COX inhibitors or selective prostaglandin 
receptor agonists on immune function, and may provide new approaches to modulation of 
the proinflammatory immune response. 



Vll 



CHAPTER 1 
INTRODUCTION 



Dendritic cells (DC) are the most potent antigen presenting cells (APC); they are 
10-100 times more potent at activating naive and memory T cells than B cells or 
macrophages (MO). Constitutive high expression of costimulatory molecules, CD80 and 
CD86, and major histocompatibility (MHC) molecules make DC unique in their ability to 
activate naive T cells (Steinman, 1991). Recently, two subsets of DC have been 
phenotypically described, a myeloid derived DC that captures antigen in the periphery 
and migrates to the draining lymph node and a lymphoid DC that resides in the lymph 
node. Functional differences in the two subsets continue to headline the DC literature 
(Shortman and Caux, 1997; Steinman et al., 1997a). DC have been shown to be 
important in both immunity and tolerance. The ability of DC to induce T cell activation 
or tolerance is dependent on the microenvironment during antigen capture and the antigen 
itself (Kalinski et al, 1999a; Steinman et al, 1997b). Antigens that fail to induce an 
inflammatory stimulus are considered safe and induce tolerance while antigens that are 
accompanied by an inflammatory signal elicit an immune response directed at antigen 
elimination (Finkelman et al., 1996). Activation of T cells by APC requires T cell 
receptor (TCR) recognition of peptide presented in MHC molecules and co-stimulation of 
CD28 on the T cell by CD80 or CD86 on the same APC. Lack of costimulation in the 
presence of TCR engagement results in anergy of the T cell and presumed tolerance of 
the antigen. 



1 



Because of their central role in the adaptive immune response, DC have become a 
favorite target for research in many clinical diseases involving T cells including allergy, 
transplantation, autoimmune disease, resistance to infection, resistance to tumors and 
immunodeficiency. In autoimmune disease, defects in stimulatory capacity of the DC 
may promote autoimmunity by impaired antigen presentation that leads to accumulation 
of autoreactive T cells or deficient generation of regulatory cells. Impaired or suboptimal 
T cell activation may be sufficient to induce T cell proliferation but not strong enough to 
induce a tolerogenic or protective response, as generation of regulatory cells and 
elimination of activated T cells requires a quantitatively higher level of activation than 
what is required for T cell proliferation (Serreze et al., 1993). In human autoimmune 
insulin dependent diabetes (IDD), defects in APC function have been described. 
Monocyte derived DC (MDC) from subjects with IDD generated by triidothronine show 
reduced ability to cluster and stimulate autologous and allogeneic T cells in vitro (Jansen 
et al, 1995). Recently, Takahashi et al. (1 998) showed that immature MDC (I-MDC) 
from subjects at high risk for IDD expressed quantitatively lower levels of CD80 and 
CD86 per cell than age/sex/human leukocyte antigen (HLA) matched controls (Takahashi 
et al, 1998). Studies in the murine model for diabetes, the non-obese diabetic (NOD) 
mouse, also suggest that DC play a protective role in the autoimmune process by 
activation of regulatory T cells (Clare-Salzler et al., 1992). 

In 1999, Litherland et al. (1999) found that monocytes from subjects at high risk 
for IDD aberrantly expressed cyclooxygenase-2 (COX-2, also referred to as 
prostaglandin synthase-2 or PGS2) and as a result produced increased quantities of 
prostaglandins. The abnormal expression of COX-2 in pre-IDD subjects contributed to 



impaired T cell activation by decreased CD25 expression and interleukin-2 (IL-2) in 
phytohemagglutin (PHA)-activated T cells when compared to normal controls. 
Inhibiting COX-2 activity with a specific inhibitor, NS398, significantly increased the 
CD25 expression and IL-2 production in PHA- activated T cells in pre-IDD subjects 
(Litherland et al., 1999). Additional studies from the same laboratory report that 
peritoneal MO from NOD mice constitutively express COX-2 and that this expression is 
responsible for enhanced prostaglandin E2 (PGE2) production (Xie, 1997). 
Prostaglandins apparently play a role in the pathogenesis of IDD as blocking the 
cyclooxygenase activity delayed the onset as well, as reduced the incidence of diabetes in 
the NOD mouse. These data suggest that abnormal expression of COX-2 in humans at 
high risk for IDD and in the NOD mouse results in increased prostaglandin production by 
MO/monocytes and limits T cell activation by APC. This limitation subsequently may 
contribute to the pathogenesis of IDD by interference with peripheral tolerance 
mechanism including generation of regulatory T cells or elimination of autoreactive T 
cells by activation induced cell death (AICD). 

Recent studies suggest that blood monocytes are an immature reservoir of cells 
with dual potential that can be recruited to the tissues and differentiate into MO or DC 
depending on the tissue microenvironment (Palucka et al., 1998). Peripheral blood 
monocytes cultured with granulocyte-macrophage colony stimulating factor (GM-CSF) 
and interleukin-4 (IL-4) for six days differentiate into cells with immature DC 
morphology (Romani et al, 1994; Sallusto and Lanzavecchia, 1994). These monocyte 
derived dendritic cells (MDC) express MHC class II molecules as well as low levels of 
costimulatory molecules CD80 and CD86. They also express CD la, a tissue DC marker, 



4 



lack CD 14, a monocyte/MO surface receptor, are highly efficient in antigen capture but 
are poor stimulators of T cells (Sallusto et al, 1995; Sallusto and Lanzavecchia, 1994). 
After the addition of a maturation stimulus such as tumor necrosis factor-alpha (TNF-a), 
lipopolysaccharide (LPS) or soluble trimeric CD40L (sCD40L), MDC upregulate MHC 
class II, CD80, CD86, induces expression of CD83, a DC specific cell surface marker 
(Zhou and Tedder, 1995; Zhou and Tedder, 1996). Matured DC also decrease 
mechanisms of antigen capture and become highly immunostimulatory (Sallusto et al., 
1995). Kalinski et al. (1997) demonstrated that when high levels of PGE2 are present in 
culture from inception, MDC do not lose CD 14 expression, express lower levels of CD la 
and produce significantly lower levels of interleukin-12 (IL-12), a proinflammatory 
cytokine. Additionally, these MDC exposed to high levels of PGE2 stimulate naive T 
cells to produce Th2 cytokines, whereas DC cultured in the absence of high levels of 
PGE2 stimulated Thl cytokines (Kalinski et al, 1997). Other studies suggest that 
exogenous PGE2 added to cultures after monocytes have differentiated into I-MDC acts 
synergistically with TNF-a to enhance maturation, indicated by increased expression of 
CD83, and stimulatory capacity of the MDC (Jonuleit et al., 1997; Reddy et al, 1997a). 
Rieser et al. (1997) also reported that addition of exogenous PGE2 increases IL-12 
secretion by MDC by a cAMP mediated mechanism (Rieser et al, 1997) while others 
have reported that PGE2 down regulates the secretion of IL-12p70 in MDC stimulated 
with LPS (van der Pouw Kraan et al., 1995; 1996). Collectively, these data suggest that 
PGE2 has a profound effect on MDC maturation and function but that the effects are 
highly dependent on the state of MDC maturation. Early exposure of monocytes to 
PGE2 limits MDC differentiation, for example, maintain CD 14 and do not express CD la, 



and promotes Th2 T cell response, while exposure to PGE2 after differentiation into I- 
MDC results in increased maturation, stimulatory capacity, and secretion of IL-12 
(Jonuleit et al, 1997; Kalinski et al, 1997; Rieser et al, 1997). 

Prostaglandins mediate their biological action through binding to specific cell 
surface and nuclear membrane receptors. Four PGE2 receptor subtypes termed EP1, EP2, 
EP3, and EP4 are coupled to intracellular signaling pathway through GTP binding 
proteins. EP1 activatrs phosphotidylinositol turnover and increases intracellular CA++ 
by an unidentified G protein. EP2 and EP4 are coupled to Gs protein and transduce 
activation of adenylate cyclase resulting in an increase in cAMP (Narumiya et al, 1999). 
EP3 has multiple isoforms with identical extracellular domains differing only in the 
cytoplasmic tail which differ in their signal transduction but most are coupled to Gi 
inhibiting AC and reducing cAMP (Negishi et al, 1995). Secondary messengers, such as 
cAMP, activated by ligation of prostaglandin receptors control cellular responses by 
stimulating protein kinases which phosphorylate transcription factors and regulate gene 
expression. 

Recent studies suggest that EP2 and/or EP4 may contribute to the pathogenesis of 
IDD. Bridgett et al. (1998) describes differential protection in two transgenic lines of 
NOD mice hyperexpressing a peptide of glutamic acid decarboxylase (GAD), a candidate 
autoantigen in diabetes. One transgene inserted into the Y chromosome provided no 
protection from diabetes while the A-line (whose transgne integrated within 6 cM from 
the centromere of chromosome 15) provided protection from diabetes in the hemizygous 
state suggesting that protection may be associated with insertional mutagenesis (Bridgett 
et al, 1998). Candidate genes in the transgene insertion region included EP2 and EP4. 



EP2 and EP4 mediate cellular response through increased cAMP and protein kinase A. It 
is possible that the increased prostaglandins reported in NOD mice mediate their affect 
through EP2 and/or EP4 and that disruption of one or both of these genes may reduce the 
level of cAMP generated when prostaglandins are present. Increases in cAMP have been 
shown to be involved in preventing apoptosis (Boehme and Lenardo, 1993; Critchfield 
and Lenardo, 1995) and cell cycle progression (Goetzl et al, 1995b; Smit et al., 1998), 
events that would interrupt peripheral tolerance mechanisms including AICD and 
possibly lead to an accumulation of autoreactive T cells. Additionally, PGE2 affects the 
secretion of IL-12 in MDC through cAMP mediated mechanisms (Rieser et al., 1997; van 
der Pouw Kraan et al., 1995; van der Pouw Kraan et al., 1996) and the maturation of 
MDC (Jonuleit et al, 1997; Kalinski et al, 1997). 

Because prostaglandins affect maturation and function of MDC (cells important in 
immunity and tolerance) and the expression of COX-2 in monocytes (immature 
reservoirs of cells with MDC potential) of subjects at risk for IDD, suggest that 
prostaglandins may contribute to the pathogenesis of IDD by modulation of DC 
maturation and function. This study was designed to answer the following questions: 
Chapter 3: Do MDC express COX-1 and COX-2? What is the eicosanoid profile 
produced by the MDC? Do endogenously produced PG regulate MDC surface antigen 
expression, capture of antigen, and secretion of IL-12? Chapter 4: Do MDC express PG 
receptors? What is the number of receptors on the cell surface? Which PG receptors 
regulate IL-12 production in MDC? Chapter 5: Do MDC generated from subjects at 
high risk for IDD have similar phenotype and function as MDC generated from normal 



controls? Does the aberrant expression of COX-2 and increased PG production in 
monocytes from subjects at high risk for IDD impairs MDC differentiation? 






CHAPTER 2 
REVIEW OF LITERATURE 



Prostaglandins: Metabolism, Function and Receptors 
Eicosanoids 

Eicosanoids are a family of oxygenated metabolites of arachidonic acid (AA) that 
mediate many cellular processes. Over the past 40 years the structures of eicosanoids, 
which consist of prostaglandins (PG), thromboxane (TBX), hydroxyeicosatetraenoic 
acids (HETES) and leukotrienes (LT), have been elucidated as well as their cellular 
location, biosynthesis and action through specific cell surface and nuclear receptors. 
Liberation of membrane AA by phospho lipases (PL A) results from external signals such 
as hormones, growth factors and cytokines, making AA available for oxygenation by 
either the linear pathway which results in generation of HETES and LT or by the cyclic 
pathway which yields PG and TBX (Piomelli, 1993). 
Prostaglandin Biosynthesis 

The biosynthesis of TBX and PG involves three sequential steps (Figure 2-1). 
The first step is the release of AA from membrane phospholipid by phospho lipase A2 
(PLA2). Next, formation of prostaglandin H2 (PGH2) from AA is mediated through two 
isoenzymes designated cyclooxygenase-1 and -2 (also referred to as COX-1, -2 or 
prostaglandin synthase- 1, -2 or PGS-1, -2). Both isoenzymes catalyze the oxygenation of 
AA to PGG2 (cyclooxygenase) and reduction to PGH2 (peroxidase) (Smith et ah, 1996). 



Membrane phospholipids 

Phospholipase 
▼ A2 
Arachidonic Acid (AA) 

| Cyclooxygenase I Cyclooxygenase 1 
Prostaglandin G2 (PGG2) 
Peroxidase 






i 



or 
Cycloxygenase 2 



Prostcyclin 
synthase 



Prostaglandin H2 (PGH2) 
Pros aglandins 



Prostacyclin (PGI2) 



PGF2a 
synthase 



PGF2a 




PGE2 



Thromboxane 
^synthase 

Thromboxane (TBX) 



PGD2 synthase 



PGD2 



Figure 2-1. Cyclic pathway of arachindonic acid metabolism leading to 
prostaglandins, prostacyclins and thromboxanes. Enzymes are italicized. 
Cyclooxygenase 1 and 2 (COX-1 and COX-2 also referred to as Prostaglandin 
Synthase 2, PGS1, and Prostaglandin Synthase 2, PGS2) has both 
cyclooxygenase and peroxidase activity. 



10 

The last step is isomeriztion of PGH2 by specific synthases to produce prostacyclin 
(PGI2), PG, and TBX, collectively referred to as prostanoids (Figure 1). 

The evolutionary pressures that led to two iso forms of COX are not clear. COX-1 
is developmentally regulated, constitutively expressed in most tissues, and primarily 
responsible for cellular homeostasis. In contrast, COX-2 is generally not expressed in 
unstimulated cells but can be induced to produce large quantities of prostanoids. The 
induction of COX-2 is not simply a matter of quantity of PG as induction of COX-2 in 
fibroblast produces little increase in overall PG production (Goetzl et al., 1995a). 
Additionally, COX-2 is expressed under non-stimulated conditions in the renal cortex and 
the brain (Seibert et ah, 1994). Evidence suggests that the COX-1 and COX-2 occupy 
different subcellular compartments and may utilize different intracellular pools of AA 
(Morita et al., 1995; Murakami et al., 1994). Immunostaining reveals that COX-1 is 
localized to the endoplasmic reticulum (ER) while COX-2 is located in the ER but 
concentrated in the nuclear envelope (NE). These data suggest that the nuclear location 
of COX-2 is important in providing PG that interact with nuclear receptors and alter gene 
expression directly by acting as transcription factors on genes that may be important in 
cellular growth, replication and differentiation (Murakami et al., 1994; Smith et al., 
1996). However, other studies in COX-1 and COX-2 null cells indicate that cells 
deficient in COX-1 or COX-2 compensate by expression of the alternative COX 
isoenzyme (Kirtikara et al., 1998). 

The human genes for COX- 1 and -2 are located on chromosome 9 and 1 , 
respectively. The structural differences in COX-1 and COX-2 genes explain differing 
patterns of expression of the two enzymes. The COX-2 gene has a TATA box as well as 



11 



a number of elements in the 5' promoter region such as a nuclear factor-kb (NFkB) site, 
CAAT enhancer and a cyclic AMP (cAMP) response element that are generally involved 
in highly regulated inflammatory genes (Appleby et al, 1994). The COX-1 gene has no 
TATA, characteristic of a housekeeping gene, and no significant inducible element has 
been identified in the promotor region. Additionally, mRNA for COX-2 but not COX-1 
has long a 3' untranslated region that contains multiple polyadenlyation sites and 
instability sequences that signal rapid message degradation (Herschman et al., 1997; 
Smith et al, 1996). 

Although COX-1 and -2 have different gene and mRNA structure as well as 
occupy different locations within the cell, the catalytic characteristics are almost identical 
except for their susceptibility to inhibition by pharmacological agents. Glucocorticoids 
inhibit expression of COX-2 while exhibiting little effect on COX-1 (Kujubu and 
Herschman, 1992;Masferrer et al, 1994). Traditional nonsteroidal anti- inflammatory 
drugs (NSAID) used to treat inflammatory diseases such as rheumatoid arthritis inhibit 
both COX-1 and -2; however, a new class of specific inhibitors that target COX-2 
(Futaki et al, 1994) has been developed that produce less ulcerogenic and nephrotoxic 
side effects than NSAID. 
Prostaglandin Receptors 

Effects of eicosanoids are mediated through binding to specific seven- 
transmembrane rhodopsin-like G-protein coupled receptors (Figure 2-2). The prostanoid 
receptors include DP, EP, FP, IP and TP, which bind to PGD2, PGE2, PGF2, PGI2 and 
TBX, respectively, and transduce secondary intracellular signals by changes in cAMP, 



12 



N-linked 
Oligosaccharides sites 




— NH3 H 



Extracellular 



<£°% 



liiliii 



Plasma 
Membrane 



*W u 8 



Intracellular 



ooc- 



Figure 2-2. Representative structure of prostaglandin receptors which are 
members of the G-protein coupled rhodopsin-type receptor with 7 putative 
transmembrane domains. Solid circles indicate hydrophobic amino acids. 
Conserved motifs include LXAXRXAS/TXNQILDPWVYIL in the 
seventh transmembrane, GRYXXQXPGS/TWCF in the second 
extracellular domain, and MXFFGLXXLLXXXAMAXER in the third 
transmembrane domain are shared by most of the prostanoid receptors. 
Different isoforms of receptors such as TBX or EP3 have identical amino 
terminal (ligand binding) and vary only in the carboxy terminal tail (G- 
protein binding/signal transduction). 



13 



Table 2- 1 : Signal Transduction of prostanoid receptors 



Type 



Subtype Isoform G protein Second Messanger 



DP 
EP 



FP 
IP 
TP 



EPI 
EP2 
EP3 
EP4 



TPa 
TPp 



Gs 

Unidentified 

Gs 

Gi 

Gs 

Gq 

Gs,Gq 

Gs,Gi 

Gq,Gs 



cAMP t 

Ca ++ t 

cAMP f 

cAMP 4 

cAMP f 

PI response 

cAMP j , PI response 

PI response, cAMP ▼ 

PI response, cAMP T 



14 

phosphotidylinositol (PI) or free CA"^ concentrations in the cell (Kiriyama et al, 
1997)(Table2-l). 

Alignment of the amino acid sequences of the eight prostanoid receptors 
including the subtypes of EP and TP reveal 28 residues that are conserved. Additionally, 
all have one or more Asn-X-Ser/Thr in the extracellular amino terminal of the protein that 
is a consensus sequence for N-glycosylation and is essential for ligand binding (Chiang 
and Tai, 1998). But despite the conserved sequences, the overall homology of the 
receptors is only 20-30% even among the subtypes of PGE2 receptors (Narumiya et al., 
1999). 

Prostaglandins play a role in various central nervous system actions including 
fever, sleep, acute inflammation and pain, thrombosis, hemostasis, bone resorption, 
hypertension, and reproduction. However, the potent immunomodulatory affects of PG, 
particulary PGE2, also suggest a role in immunity and allergy (Goetzl et al., 1995a). 
Studies in immune cells and PG suggest that the immunomodulatory effects of PGE2 are 
mediated through increases in cAMP suggesting the involvement of EP2 and/or EP4 
(Anastassiou et al., 1992; Bauman et al., 1994; Betz and Fox, 1991; Blaschke et al., 
1996; Choung et al., 1998). PGE2-specific effects on immune function will be discussed 
in subsequent paragraphs. 

Dendritic Cells 
Initiators of the Immune Response 

Adaptive immune response results from antigen uptake, processing and 
presentation by APC to T cells in lymphoid organs. Among professional APC including 
DC, MO, and B-cells only DC are highly effective at stimulating naive T cells because of 



15 

constitutive expression of costimulatory molecules, CD80 and CD86, and high 
expression of MHC class II molecules required for T cell activation. Immature DC are 
distributed throughout the body and equipped with mechanisms to optimize antigen 
capture including macropinocytosis, receptor-mediated endocytosis vis C-type lectin 
receptor, Fey receptors I and II for uptake of immune complexes or opsonized particles, 
CD36 and avp5 integrins involved in phagocytosis of apotoptic and necrotic cells and 
entry of intracellular parasites, bacteria, and viruses. Recently, a new receptor, DC-SIGN 
was identified which, unlike the receptors that mediate antigen uptake which results in 
antigen processing and presentation of peptide in MHC molecules to T cells, this receptor 
binds to human immunodeficiency virus (HIV) and transports HIV to the draining 
lymphnode where the receptor promotes binding and transmission of HIV to T cells 
(Geijtenbeek et al., 2000). This mechanism, which is important in the pathogenesis of 
HIV, may be involved in transport of other pathogens to target sites but to date only HIV 
transport has been reported. 

Following capture of antigen, DC migrate to the lymph node via the afferent 
lymph where they upregulate MHC and costimulatory molecules and activate T cells. 
Recent data indicate that the microenvironment during antigen capture polarize the DC so 
that it not only provides signal 1 (peptide bound to MHC) and signal 2 (costimulatory 
molecules) but also provides signal 3 in the form of release of polarizing cytokines that 
directs the bias of Th cells towards Thl or Th2 (Kalinski et al., 1999a). A crucial factor 
in the polarization towards Thl or Th2 cytokine production is the presence of IL-12 or 
IL-4, respectively, during T cell receptor (TCR) engagement (Abbas et al, 1996). DC 
are known producers of IL-12 but do not produce IL-4 (de Saint-Vis et al., 1998). 



16 

Interleukin-12 

Interleukin-12 is a heterodimeric cytokine that is involved in priming the naive T 
cell for high IFN-y secretion resulting in a proinflammatory immune response. 
Heterodimeric IL-12 or IL-12p70 is composed of two subunits of two chains, p35 and 
p40, that are covalently linked. IL-12p40 is also secreted as a monomer or homodimer 
generally in excess of 10-100 times that of the biologically active cytokine (Gately, 1999; 
Sutterwala and Mosser, 1999). The biological activity of IL-12p40 homodimers is not 
well defined, but several studies in human and mouse suggest that the IL-12p40 
homodimer is an IL-12 receptor antagonist (Gillessen et al., 1995; Ling et al., 1995) and 
may reduce the Thl response (Yoshimoto et al., 1998). Inducers of IL-12 in DC and 
other APC include LPS, CpG motifs contained in bacterial DNA, and activated T cells 
through direct interaction of CD40 with CD40L on the T cell (Macatonia et al., 1995; 
Shu et al., 1995). Hilkens et al. (1997) found that IFN-y was an obligatory signal required 
for DC secretion of the biologically active form of IL-12 via CD40-CD40L (Hilkens et 
al., 1997). Three well-described inhibitors of IL-12 biosynthesis include IL-10, 
transforming growth factor-P (TGF-P) and PGE2 (Strassmann et al., 1994; Sutterwala et 
al, 1997; van der Pouw Kraan et al., 1995). 

In vivo and in vitro studies concluded that IL-12 is critical in the development of 
immunity against intracellular pathogens. Animals treated with anti-IL-12 or that lack 
the IL-12p40 gene are more susceptible to intracellular pathogen infection (Mattner et al., 
1993; Scharton-Kersten et al., 1995). Conversely, overproduction of IL-12 has 
detrimental consequences including exacerbation of autoimmune disease as reported in 



17 

IDD (Trembleau et al, 1995) while administration of IL-12p40 to NOD mice prevented 
disease (Rothe et al, 1997; Trembleau et al, 1999). 
Lineages of Dendritic Cells 

The multiple lineages and functions of DC remain complex. Clearly, subsets of 
DC are derived from hematopoietic progenitor cells. Three distinct hematopoietic DC 
have been described in the literature (Figure 2-3). Thymic DC and a subset of DC found 
in the lymph node and spleen originate from a lymphoid lineage. In humans, culturing 
CD34+ progenitors with IL-3 or flt3-ligand generates lymphoid DC that express CD8a. 
Shortman et al.(1997) found that in murine lymph nodes two population of DC exist, a 
CD8a+ (lymphoid DC) and CD8a- (non lymphoid) population. Both populations express 
similar levels of HLA molecules, and costimulatory molecules CD80 and CD86, but 
activate T cells differently. T cell proliferation studies demonstrated that lymphoid DC 
did not activate CD8+ T cells as efficiently as non- lymphoid cells because of an 
inadequacy of the lymphoid DC to induce IL-2 production. Additionally, lymphoid and 
non lymphoid DC effectively activated CD4+ T cells but lymphoid DC eliminated the 
CD4+ T cells after activation by FAS mediated apoptosis. These authors suggest that 
because of the deletion of T cells via FAS-FASL interaction, lymphoid DC may play a 
role in peripheral tolerance (Banchereau and Steinman, 1998; Heath et al, 1998; 
Shortman and Caux, 1997). 

A second subset of hematopoietically derived DC can be differentiated by 
culturing CD34+ precursors with GM-CSF and TNF-cc. This yields a DC that is positive 
for CD la and expresses markers similar to a Langerhan's cell (LC) or epidermal DC 
(Caux et al, 1995; Caux et al, 1997). A third hematopoietically derived DC also begins 



18 



+ , 

ss 

U U 



, + + 

^- ro id 

•H CD »H 

□ 3 O 
U U U 



. + . 






8 




u 
u 

u 

! 



o 

o. 
E 
>» 



T3 

_o 

3 
>. 

E 
« 

1 

n. 

c 
o 

1 

a 

_o 

to 

'S 
p. 

1 

a 

i 
CI 



op 



19 

with a CD34+ progenitor but has a transient CD 14 + state. These DC can also be derived 
from culturing peripheral blood monocytes (CD 14+) with GM-CSF and IL-4 for 6-8 
days, which yields a monocyte derived dendritic cell (MDC) (Romani et al., 1994; 
Sallusto and Lanzavecchia, 1994). The latter two populations are both myeloid lineage 
DC and express similar levels of CD la, CD1 lc, CD40, CD80, CD86, HLA-DR but can 
be differentiated by expression of CD64 and E-cadherin which are expressed on CD34+ 
derived DC but not on MDC (Caux et al., 1997; de Saint- Vis et al, 1998). 

It has been suggested that the key distinction between lymphoid DC and myeloid 
DC may be tolerance versus immunity (Banchereau and Steinman, 1998; Shortman et al., 
1997); however, recent studies suggest that both lymphoid and myeloid DC have the 
ability to exhibit tolerogenic activity (Inaba et al, 1998; Suss and Shortman, 1996). 
Dendritic cells tolerized by TGF-(3 or IL-10, or genetically engineered DC expressing 
immunosuppressive activity such as TGF-P, IL-10 or molecules that induce apoptosis 
such as FASL, may provide mechanisms for tolerance induction for treatment of 
transplant rejection and autoimmunity (Lu, 1999). 

Polarizing Thl and Th2 Responses in Naive T cells 

Until recently myeloid DC were thought to only stimulated Thl producing T cells 
by virtue of their ability to secrete IL-12. Recent studies in vitro and in vivo suggest that 
myeloid DC can induce Thl or Th2 cytokine production in naive T cells (Macatonia et 
al., 1995; Ronchese et al., 1994; Stumbles et al., 1998). The determining factor in 
skewing the Th response by the DC is the secretion of IL-12 (Abbas et al, 1996; Snijders 
et al, 1998) and the amount of IL-12 secreted by the DC is directed by the 
microenvironmental factors present during antigen capture as well as the antigen itself 



20 

(Jonuleit et al, 1997; Kalinski et al, 1999a; Kalinski et al, 1999b). Microenvironmental 
tissue factors that have been shown to affect IL-12 modulation are PGE2, IL-10, TGFP 
and IFN-y (De Smedt et al, 1997; Kalinski et al, 1998). 

Several pathogens, including intracellular bacteria and helminthes, have been 
shown to modulate secretion of IL-12 by DC (Bancroft et al, 1997; Snijders et al, 1998; 
Trinchieri, 1997; Trinchieri, 1996). Additionally, other pathogens including intracellular 
parasites such as Leishmania major induce production of IL-12 inhibitory factors in the 
host which down modulate IL-12. Viruses such as HIV and measles virus have also been 
shown to interfere with the production of IL-12 in DC (Karp, 1999; Marshall et al, 1999; 
Weissman et al, 1996). 

Effects of Prostaglandins on Dendritic Cell Maturation and Function 

Few studies have examined the effects of PG on the differentiation and maturation 
of MDC. Kalinski et al. (1997) showed that PGE2 added to cultures at high 
concentration (lO^M) prevent the differentiating monocyte from acquiring the CD la 
marker and losing the monocyte marker, CD 14. Additionally, the presence of PGE2 
inhibited the ability of the matured MDC to produce IL-12p70 and, therefore, induces 
Th2 cytokine production (Kalinski et al, 1997). The addition of PGE2 into cultures, in 
combination with other maturation stimuli, such as TNF-a, LPS, or sCD40L, after the 
differentiation process from monocyte to I-MDC was complete enhances maturation, 
migratory, and immunostimulatory capacity of the MDC (Jonuleit et al, 1997; Reddy et 
al, 1997). Rieser et al. (1997) reported that PGE2 in the absence of LPS stimulated the 
production of total IL-12 (Rieser et al, 1997) while other have reported that PGE2 is a 



21 






potent inhibitor of IL-12 production (Strassmann et al, 1994; Sutterwala et al, 1997; van 
der Pouw Kraan et al, 1995; van der Pouw Kraan et al, 1996). Although the studies by 
Reiser et al. (1997) and van der Pouw Kraan et al.(1995) report increased and decreased 
production of IL-12, respectively, in response to PGE2, both suggest that the mechanism 
of action is through increase in cAMP production suggesting that the regulation of IL-12 
by PGE2 may be through EP2 and/or EP4. Finally, Kalinski et al. (1998) found that fully 
matured MDC are unresponsive to PGE2 regulation of IL-12. These data suggest that the 
diverse response by MDC to PGE2 is highly dependent on the maturation stage of the 
MDC (Kalinski et al, 1998). The autocrine effects of endogenously produced PG on the 
maturation and function of MDC as well as the distribution of prostaglandin receptors on 
MDC have not been examined, but are the focus of Chapter 3 and Chapter 4, 
respectively. 

Pathogenesis of Diabetes 
Autoimmune insulin dependent diabetes (IDD) results from a cell mediated 
immune response that destroys the insulin producing cells of the pancreas (P cells of the 
islets of Langerhan's). Although T cells are critical to the pathogenesis of IDD, MO and 
DC may contribute as the initiation of the autoimmune process begins with the 
presentation of P cell specific antigens by APC to autoreactive CD4+ T cells. 
Alternatively, DC have been shown to be important in induction of tolerance through 
generation of regulatory T cells (Clare-Salzler et al, 1992), anergy (Kirk et al, 1997; 
Larsen et al, 1996), and AICD (Suss and Shortman, 1996). Initially, MO and DC 
infiltrate the islet of Langerhan's (Dahlen et al, 1998) followed by T cell infiltration and 
Thl mediated destruction of the insulin secreting p cells. The secretion of IL-12 by the 



22 

APC polarizes the immune response toward Thl and induces the secretion of interferon-y 
(IFN-y) by Thl cells. IFN-y activates MO causing release of inflammatory cytokines 
such as interleukin-lp (IL-lp) and tumor necrosis factor-a (TNF-a) as well as free 
radicals. This release of cytokines results in increased apoptosis and/or necrosis of 
p cells (Dahlen et al, 1998; Delaney et al, 1997; Heitmeier et al., 1997). 

IDD susceptibility is associated with many genes including genes of MHC class 
II. The most significant association is with MHC class II haplotypes DR3-DQB1 *201 
and DR4-DQB1 *302. Although the MHC molecules are critical for presentation of 
antigen to CD4+ T cells and the pathogenesis of IDD attributed to accumulation of islet 
antigen specific Thl cells, the mechanism of immune dysregulation in IDD has not been 
fully defined. The accumulation of autoreactive T cells may result from failure of 
elimination by activation induced cell death, induction of anergy, or deficient generation 
of regulatory cells caused by impaired antigen presentation. In humans with IDD as well 
as the murine model, the NOD mouse, inability of the APC to activate T cells has been 
described including decreased clustering, decreased production of IL-2, and deficient 
activation of regulatory cells (Clare-Salzler and Mullen, 1992; Jansen et al, 1995). 
Prostaglandins and Pathogenesis of IDD in Humans and NOD 

As stated previously, PG, especially PGE2, have diverse effects on the immune 
response. PGE2 can modulate T cell differentiation, tissue migration and effector 
function. PGE2 protects thymocytes from activation-induced apoptosis through 
thymocyte expression of EP2 and increased cAMP (Goetzl et al., 1995b). Migration of T 
cells across basement membranes is enhanced by PGE2 (through EP2 and increases in 
cAMP) and secretion of matrix metallproteinases (Leppert et al., 1995). Finally, PGE2 



23 

modulates T cell effector function by inhibiting the production of IL-2 and IFN-y and the 
expression of CD25 (a-chain, IL-2 high affinity receptor) (Anastassiou et al., 1992; 
Hancock et al, 1988; Katamura et al, 1995). The inhibition of CD25 and IL-2 
production leads to inhibition of proliferation and subsequently blocked AICD that is 
required for elimination of T cells after activation (Bauman et al, 1994). One group 
reports that previous studies on the effects of PGE2 used high concentrations that are 
above physiologic levels, and that physiologically relevant concentrations of PGE2 
actually enhance the production of IFN-y by antigen-stimulated Thl cells (Bloom et al, 
1999). A recent report suggests that different strains of mice have sensitivity differences 
to the suppressive effect of PGE2 possibly through the number of prostaglandin 
receptors, and that this difference may account for preferential polarization to a Th2 
response in Balb/c mice (Kuroda et al, 2000). Studies in the NOD strain have not been 
reported. 

Until recently, the suppressive effects of PGE2 in NOD mice had not been 
studied; however, Ganapathy et al. (2000) recently suggested that PGE2 may be a less 
effective negative regulator of activated CD8+ T cells IFN-y secretion in NOD than in 
Balb/c mice (Ganapathy et al., 2000). PG apparently play a role in the pathogenesis of 
disease since blocking endogenous production of PG delays onset and decreases 
incidence of diabetes in NOD mice (Xie, 1997). Xie (1997) reported that peritoneal MO 
from NOD mice constitutively expressed the normally inducible COX-2 enzyme and that 
this constitutive expression was responsible for increased production of PGE2. 
Litherland et al. (1999) reported similar findings, aberrant expression of COX-2 in human 



24 

peripheral blood monocytes, from subjects at increased risk for IDD (Litherland et al, 
1999). 

The possible role of PG receptors in the pathogenesis of diabetes was suggested 
by Bridgett et al.(1998) when two transgenic lines of NOD mice overexpressing the 
putative autoantigen GAD (Kaufman et al., 1993) in pancreatic p cells had differential 
protection from diabetes. The Y-line integrated in the Y chromosome but showed similar 
incidence of diabetes in male NOD than the standard NOD males, while the A-line which 
incorporated into the proximal end of chromosome 15, where the genes for murine EP2 
and EP4 are located, exhibited a markedly lower incidence of diabetes in both sexes. 
Additionally, the ratio of IFN-y to IL-10 transcripts was reduced in the A-line suggesting 
that the insertional mutagenesis is a possible mechanism in the A line protection from 
diabetes (Bridgett et al, 1998). 

Collectively, these studies suggest that PG could play a major role in the 
pathogenesis of diabetes. First, activation of regulatory T cells for induction of tolerance 
requires a highly immunostimulatory APC such as MDC. Subjects with a high risk for 
IDD and NOD mice aberrantly express COX-2 and produce PG that could affect 
differentiation and the immunostimulatory capacity of MDC. Second, increased 
prostaglandin production during T cell activation may lead to decreased IL-2 production 
and increased cAMP mediated antiapoptotic that could impair activation induced cell 
death, a mechanism required for peripheral tolerance. Chapter 5 describes a comparative 
study of MDC in normal human controls and subjects at high risk for IDD to ascertain if 
atypical expression of COX-2 in subjects at high risk for IDD impair MDC maturation 
and function. 



CHAPTER 3 

AUTOREGULATION OF HUMAN MONOCYTE DERIVED DENDRITIC 

CELL MATURATION AND FUNCTION BY CYCLOOXYGENASE-2 

MEDIATED PROSTAGLANDIN PRODUCTION 



Review of Literature 

Prostaglandins are important lipid mediators for a wide variety of physiological 
cellular functions (Crofford, 1997; Morita et al, 1995; Smith et al, 1996; Williams and 
Shacter, 1997). Prostaglandin synthesis is regulated by a series of steps involving the 
release of endogenous arachidonic acid (AA) by phospholipase A2 (PLA2), and the 
subsequent conversion of AA to prostaglandin H2 (PGH2). Conversion of AA to PGH2, 
the first and rate limiting step in prostaglandin biosynthesis, is mediated through two 
isoenzymes, cyclooxygenase 1 (COX-1 also referred to as prostaglandin synthase- 1, 
PGS-1) and cyclooxygenase-2 (COX-2, also known as PGS-2). Constitutively expressed 
COX-1 is primarily responsible for cellular homeostasis while COX-2 is inducible and is 
responsible for high-level production of prostanoids that modulate inflammation and 
mitogensis (Brock et al, 1996). Monocyte expression of COX-2 is induced by a variety 
of stimuli including LPS, PMA, and IL-lp (Hwang et al, 1997; Yamaoka et al, 1998). 
In monocytes, LPS upregulates COX-2 through induction of GM-CSF while IL-ip 
enhances and stabilizes COX-2 transcripts. In several cell types including monocytes, 
COX-2 expression is suppressd by IL-4, IL-10 and IL-13 via transcriptional and 
postranscriptional regulation (Endo et al., 1996). 



25 



26 

Expression of COX enzymes, prostanoid production, and the autocrine effects of 
these molecules have not been reported for MDC. Previous studies, however, described 
the effects of exogenous prostaglandins on MDC maturation and function. Kalinsky et 
al. (1997) demonstrated that high concentration (10" 6 M) of exogenous PGE2 added to 
monocytes in the presence of GM-CSF and IL-4 profoundly modulated MDC 
development as these cells do not lose CD 14, expressed low levels of CD la, and 
produced significantly less IL-12p70 and higher levels of IL-10 (Kalinski et al., 1997). 
Additionally, MDC derived under these conditions stimulated Th2 responses whereas 
MDC cultured without exogenous PGE2 stimulated Thl responses. Other studies 
demonstrated that exogenous PGE2 (lO^M), when added to cultures following monocyte 
differentiation into I-MDC, synergized with TNF-ct or TNF-a/IL-l/IL-6 at 10" 8 M to 
induce maturation, immuno-stimulatory capacity and IL-12 production (Jonuleit et al., 
1997; Reddy et al., 1997a). These published studies demonstrate that exogenous 
prostanoids markedly affect MDC maturation and function and that the effect is highly 
dependent on the developmental stage of the MDC. Preliminary data from our laboratory 
suggested that MDC express COX-2 constitutively; therefore, we asked if MDC 
expressed COX-1 and COX-2 and produced prostaglandins that in an autocrine manner 
regulated MDC maturation and function? 

Materials and Methods 
Isolation of Monocytes and Dendritic Cell Culture Conditions 

PBMC were isolated from buffy coats from one unit of whole human blood using 
Histopaque Ficoll (Sigma, 1.077, endotoxin tested, St. Louis, MO). Cells were washed 
two times with Dulbecco's PBS (DPBS), Ca^ and Mg^ free (Cellgro, endotoxin tested) 



27 

and resuspended in RPMI 1640 media with L-glutamine (Gibco, BRL, Grand Island, NY) 
supplemented with 10% fetal calf serum (Hyclone, endotoxin tested, Logan, UT), and 1% 
streptomycin, penicillin, neomycin (Sigma). PBMC were allowed to adhere for 2 hours 
at 37°C, 5% C0 2 , 100% humidity and non-adherent cells were washed away with DPBS. 
Complete RPMI tested negative for endotoxin (<2.0 EU/ml) (E-Toxate® Kit, Sigma). 
Adherent cells were cultured for 6 days in complete RPMI supplement with 500 U (50 
ng/ml) GM-CSF (Endogen, Woburn, MA) and 500-1000 U IL-4 (R&D Systems, 
Minneapolis, MN) to generate I-MDC (Sallusto and Lanzavecchia, 1994). To generate 
M-MDC, day 6 I-MDC were harvested, washed and re-plated at 3.0 X 10 5 cells/ml and 
supplemented with 1 ng/ml sCD40L (gift from Immunex, Seattle WA) and/or 1000 U of 
IFN-y (human recombinant, Endogen). Some cultures were supplemented with NS-398 
(Cayman Chemical, Cambridge, MA), a specific COX-2 inhibitor (lu-g/ml), or 
Indomethacin (Sigma) (10p.g/ml), a COX-1 and COX-2 inhibitor. 
Surface and Internal Protein Analysis 

The following monoclonal antibodies directed against surface or internal proteins 
were used: CD 14, HLA-DR (Becton-Dickinson, San Jose, CA), CD la, CD86, CD80, 
CD40 (Pharmingen, San Diego, CA), CD83 (Coulter-Immunotech, Miami, FL), and 
COX-2 (FITC, Cayman Chemical). Appropriate fluorochrome labeled isotype control 
antibodies were used. Cells were suspended in PBS with 1% BSA (reagent grade, 
Sigma) and 0. 1% Sodium Azide (Sigma). For surface marker labeling, cells were 
incubated with 1 p.g of fluorochrome conjugated antibody/1 X 10 6 cells for 20 minutes at 
room temperature, then washed one time with 2.0 ml of PBS and resuspended in 500 ul 
of 1% formaldehyde in PBS. Intracellular labeling of COX-2 was performed as 



28 

previously described (Litherland et al, 1999). All cells were analyzed on Becton- 
Dickinson FACSCalibur or FACSort. Flow Cytometry data were analyzed and median 
fluorescent intensity calculated with WinMidi© (Version 2.7, Joseph Trotter). 

Cultured MDC were washed with PBS supplemented with protease inhibitors (1 
pg/ml of each leupeptin, pepstatin and aprotinin, Sigma) and 5 p-g/ml indomethacin and 
frozen at -70°C. Lysates were thawed, sonicated and centrifuged for 10 minutes at 
14,000 rpm. Equal quantities of protein were separated by SDS-PAGE with a 10% Tris- 
HCL gel (Biorad), and transferred to nitrocellulose (Optitran, Schleicher and Schull, 
Keene, NH.) Nitrocellose was probe with monoclonal antibodies directed against COX-1 
and COX-2 (Cayman Chemical) and secondary antibodies (anti-mouse IgG-horseradish 
peroxidase, Amersham, Arlington Heights, IL). Peroxidase activity was detected by 
chemiluminescence (ECL Western Blotting detection system, Amersham Life Sciences). 
PGE2 and Cytokine Assays 

Supernatants from cultures of MDC were harvested for analysis of PGE2 and IL- 
12. 1-MDC were cultured for 6 days, washed from the plate, counted and re-plated at 
3X10 5 cells/ml in media containing GM-CSF and IL-4. I-MDC were cultured for an 
additional 48 hours before supernatants were harvested for analysis. Supernatants from 
maturing M-MDC were prepared by harvesting I-MDC on day 6, re-plating these cells at 
the same density in media containing GM-CSF, IL-4 and maturation stimuli. Cells were 
cultured for an additional 48 hours and then supernatants harvested. MDC culture 
supernatants from various conditions were analyzed for IL-12p70 and IL-12p40 (gift 
from Dr. Maurice Gately, Hoffman Roche, Nutely, NJ), by ELISA in duplicate as 
previously described (Zhang et al., 1 994). The lower limit of IL- 1 2p40 and IL- 1 2p70 



29 

detection in this assay is 15.6 pg/ml. Supernatants for IL-10 were measured by ELISA 
(Endogen, capture antibody clone 9D7 and detection antibody, clone 12G8 biotinylated). 
The lower limit of detection for IL- 1 is 20.5 pg/ml. PGE2, PGD2, PGF2a and 
thrombaxane were measured by competitive enzyme immunoassay (Cayman Chemical). 
The limit of detection for this assay is 30 pg/ml. Cytokine and prostanoid values were 
standardized to pg/ml/ 1 X 10 6 cells. 
Antigen Uptake Measured by FITC-Dextran and Lucifer Yellow 

Mannose receptor-mediated endocytosis was measured by the cellular uptake of 
FITC-Dextran ( FD, 40,000 MW, Molecular Probes, Eugene, OR) and quantitated by 
flow cytometry. Approximately 1.5 X 10 5 MDC were incubated in complete RPMI with 
25 mM Hepes and 1 mg/ml of FITC-Detran for 1 hour at °C and 37°C. After 1 hour, 
cells were washed four times with ice-cold IX PBS with 0. 1% sodium azide and 
immediately run on the flow cytometer. Fluid-phase endocytosis by macropinocytosis 
was measured by cellular uptake exactly as described for uptake of FD except 1 mg/ml 
Lucifer Yellow (LY, dipotassium salt, Molecular Probes) was used. Mean fluorescent 
intensity (MFI) of 37°C - 0°C (baseline) was used to evaluate antigen uptake in different 
maturation states of MDC. 

Results 
MDC Express COX-1 and COX-2 

To determine whether MDC express COX-2, we employed an established 
protocol employing GM-CSF and IL-4 to generate I-MDC from peripheral blood 
monocytes (Sallusto and Lanzavecchia, 1994). After six days in culture, I-MDC were 
harvested and washed then re-plated and cultured for an additional 48 hours in new media 



30 



COX-2 72 kd 



1 2 3 



B 



COX-1 68 kd 



12 3 4 



Intracellular COX-2 



3 10 4 10' 10 2 10 J 10 4 



D 



COX-2 72 kl 



1 2 3 



Figure 3-1. Monocyte derived DC express COX-2. SDS page electrophoresis 
with a 10% Tris-HCL gel loaded with 30 ug of protein from MDC cell lysates 
and 10 ug of protein from monocytes cell lysates. (A) COX-2 and (B) COX- 
1 expression in Lane 1 : 1-MDC (GM-CSF and IL-4 for 8 days), Lane 2: M- 
MDC matured with lug/ml CD40L only , Lane 3: M-MDC matured with 1 
Ug/ml CD40L and 1000 U/ml IFN-y. (C) Intracellular staining of COX-2 with 
FITC conjugated monoclonal antibody (filled histogram is anti-COX-2 and 
open histogram is isotype control) in I- MDC (A) (M-MDC not shown.) . (D) 
COX-2 expression in monocytes cultured for 24 hours Lane 1 xomplete RPMI, 
Lane 2: 1 ug/ml LPS, Lane 3: 1 ug/ml LPS with 500 U/ml of IL-4. 



31 

containing GM-CSF and IL-4. MDC maturation was stimulated by culturing I-MDC 
with either soluble trimeric CD40L (sCD40L) in the presence or absence of human 
recombinant IFN-y for the same 48-hour period. Cells and culture supernatants were 
harvested at the 48 hours time point for analysis. 

We first analyzed the MDC from these cultures for COX-1 and COX-2 expression 
by intracellular flow cytometry (Litherland et al, 1999) and immunoblotting. As seen in 
Figure 1 A and IB, I-MDC, I-MDC stimulated with IFN-y only, sCD40L only, and 
sCD40L/IFN-y constitutively express COX-1 and COX-2. We were also able to detect 
intracellular COX-2 expression by flow cytometry (see Figure 3-1C) and further establish 
expression in MDC. This is in marked contrast to monocytes that express COX-1 
constitutively (data not shown) but require LPS induction for COX-2 expression (Figure 
ID). Of interest, while monocyte COX-2 is readily suppressed by 500 U/ml of IL-4 
(Figure 3- ID, Lane 3), the same concentration of IL-4 present in MDC cultures does not 
regulate COX-2 in either I- or M-MDC (Figure 3-1 A and B). Interleukin-10, also, does 
not suppress COX-2 (data not shown). These findings with MDC are in marked contrast 
to several studies demonstrating that LPS-induced monocyte COX-2 expression is readily 
down regulated by anti- inflammatory cytokines IL-4, IL-10 and IL-13 (Endo et al., 1996; 
Niiro et al., 1995). However, our results are similar to findings by Maloney et al. (1998) 
that showed COX-2 induced by LPS or GM-CSF in neutrophils was not down regulated 
by IL-4 or IL-10 (Maloney et al, 1998). These data suggest that GM-CSF, IL-4 or factors 
produced in culture by monocytes or the differentiating process induce COX-2 in manner 
that provides resistance to cytokine regulation. 



32 



Immature MDC 



60000 

% 50000 
u 

40000 

1 30000 
°* 20000 



10000 





PGE2 



TBX 



PGF 



<15pg/ml 



PGD2 



Figure 3-2. Prostanoid production in immature monocyte derived dendritic 
cells. TBX = Thromoboxane, PGF = PGF2ot. Concentration of 
agonist/antagonist isl X 10" 6 M. Data represents one of at least three sets 
performed. Prostanoids are expressed in pg/ml/ 1 X 10 6 cells. 



33 

Prostanoid Production by I-MDC and M-MDC 

Next, COX-1 and COX-2 mediated prostanoid production by MDC populations 
was examined. Supernatants of I- and maturing M-MDC cultured in the presence and 
absence of NS-398, a specific COX-2 inhibitor, or indomethacin, a COX-1 and -2 
inhibitor, added during the last 48 hours of cell culture were analyzed. Results show 
MDC (in the absence of inhibitors) spontaneously produce thromboxane (TBX) > PGE2 
> prostacyclin but no PGD2 (Figure 3-2). NS-398 and indomethacin significantly reduce 
PGE2 production to a similar degree, suggesting that prostanoid synthesis occurs 
predominantly through COX-2 in I-MDC (Figure 3-3). It is possible that small numbers 
of residual monocytes, approximately 1% of our cultures, produce large quantities of 
prostanoids and account for COX-2-mediated prostaglandins. Although this possibility 
exists, monocytes do not express COX-2 during culture without activation. Furthermore, 
the expression of this enzyme is readily suppressed in monocytes by the presence of IL-4 
in the culture (see Figure 3- Id). 

Next, production of prostaglandin by I-MDC undergoing maturation when 
stimulated for 48 hours with sCD40L was evaluated. MDC cultured in these conditions 
synthesize two-fold more PGE2 but utilize primarily COX-1 since indomethacin but not 
NS-398 markedly reduced prostaglandin production (Figure 3). We also evaluated the 
effects of IFN-y on sCD40L mediated maturation because this cytokine in combination 
with sCD40L strongly influences MDC function and development especially secretion of 
IL-12p70 (Hilkens et al., 1997). When MDC are matured with sCD40L in combination 
with IFN-y, a 3-4 fold increase in COX-2 mediated PGE2 prostaglandin production 
occurs which is reduced toI-MDC levels in the presence of NS-398 (Figure 3-2). 



34 



6000 




I-MDC 



CD40L 



CD40L+IFN 



Figure 3-3. PGE2 production by I- and M-MDC is suppressed by a COX-2 
specific inhibitor. PGE2 was measured by competitive immunoassay and 
expressed as pg/ml/1 X 10 6 cells. Data represents the mean and SEM of at 
least four independent experiments, *p<0.05 as calculated by one-way 
ANOVA. 



35 



Interferon-y also stimulated a two-fold increase in COX-2 dependent PGE2 production 
from I-MDC. The effects of IFN-y on COX-2-mediated prostaglandin production by in I- 
MDC and maturing MDC may be related to the increased access of COX-2 to substrate, 
as this cytokine readily stimulates AA release through G-protein mediated activation of 
PLA2 (Visnjic et al., 1997). Overall, these data suggest that the synthesis of prostanoids 
through COX-2 is the default pathway for I-MDC, whereas stimulation of I-MDC by 
sCD40L in the absence of IFN-y switches AA metabolism to COX-1 . However, when 
inflammatory stimuli such as IFN-y or LPS and TNF-oc are present, COX-2-mediated 
prostaglandin synthesis again predominates. 

The quantity of PGE2 produced by MDC (10~ 9 M) is relatively small in 
comparison to LPS activated monocytes which produce micromolar quantities of PGE2. 
It is not readily evident why quantitative differences in prostaglandin metabolism exist 
between these two types of myeloid cells. Based on the Western blots, monocytes do not 
express a greater mass of COX-2 than MDC. Therefore, it may be that the presence of 
IL-4 in MDC cultures limits PLA2 activity and substrate availability (Nassar et al., 
1994). However, culturing MDC in the absence of IL-4 for 24 hours increased PGE2 
production, but the prostaglandin levels remained in the nanomolar range. Alternatively, 
higher levels of AA may be liberated when monocytes are stimulated by LPS. However, 
stimulation of maturing MDC with LPS or TNF-a leads to only nanomolar quantities of 
PGE2. Thus the quantitative set point for production of prostanoids by MDC appears to 
be substantially lower than that of macrophages or monocytes. 



36 



mdc A Vi L L L k k L L 

l ^ T(m "iwi'v* it WV if «• ffwwwif nm wTTiv it v wit* itunttt* 



M-MDC 

NS398 



I-MDC 

NS398 

6 

z 



; k L k L k k k L 

.O KBV Wi^TTr WotV WViVic MSwV Hm 7!wV Wsitt 



YVAUV VAVVA* Tcw*« VAVW '»#*-v# VAWA* Vi-h^'h* w^TV 



nt r ivi¥io' V 



rciViViVw rfii'lViVv 



2(L :U k, ;k L 

tf«'4'Wr Irbtrlttr WWV tfWWV ?m 

Fluorescence 

Intensity 
HLA-DR CD80 CD86 CD40 CDllbCDllc CDla CD14 



Figure 3-4. Blocking cyclooxygenase activity does not affect expression of 
HLA-DR and costimulatory molecules on I-MDC or MDC. I-MDC were 
cultured with GM-CSF and IL-4 in presence and absence of COX-2 
inhibitor, NS-398. M-MDC cultured for six days with GM-CSF and IL-4 
then matured in the presence or absence of NS-398 with soluble trimeric 
CD40L and IFN-y. MDC were stained with antibodies to cell surface 
markers conjugated to fluorochromes listed in Materials and Methods. Filled 
histogram indicates cell surface staining and open histogram represents 
isotype antibody staining. 



37 

COX-2 Mediated Prostaglandin Synthesis Promotes MDC Maturation 

To establish whether endogenous prostaglandins affect differentiation of I-MDC 
from monocytes, surface antigen expression of CD la, CD 14, CD40, CD80, CD86, CD83 
and HLA-DR on these cells cultured in the presence and absence of NS-398 was 
analyzed (Figure 3-4). These data demonstrate that blocking endogenous COX-2 
mediated prostanoid production did not affect expression of CD la, HLA-DR or the 
expression of the co-stimulatory molecules during differentiation from monocytes to I- 
MDC (Figure 3-4). These data are consistent with Kalinski et al. (1997) who reported 
that MDC exposed to 10" 9 M exogenous PGE2, equivalent to levels produced by I-MDC, 
did not affect MDC differentiation from monocytes (Kalinski et al., 1997). 

The same series of antigen markers on I-MDC matured with sCD40L and 
sCD40L with IFN-y in the presence of either NS-398 or indomethacin were examined. 
Again, blocking COX-2 in MDC stimulated with sCD40L/IFN-y did not modify 
expression of CD40, CD80, CD86 or HLA-DR (Figure 3-4). Additionally, when 
indomethacin was used to block COX-1, the predominant enzyme metabolizing 
arachidonate in MDC matured with sCD40L alone, likewise there was no affect on 
expression of these same antigens. Previous studies demonstrated that micromolar 
concentrations of PGE2 enhanced I-MDC maturation when used in cell culture in 
combination with LPS, TNF-oc, or a mixture of inflammatory cytokines (Jonuleit et al, 
1997; Reddy et al., 1997a). However, in the present studies we did not find that reducing 
prostaglandins limited MDC maturation based on the expression of these antigens. It 
appears that large quantities of PGE2, such as that produced by macrophages, are 
required to modulate surface molecules such as CD86. 



B 



38 



10' 10' 10 ! 10 1 10" 

I-MDC 



1 10' 10 1 10 : 10' 

SCD40L 



10° 10' 10' 10 : 10 4 

SCD40L + 

IFN-y 



L 

I-MDC + 
NS398 



s 






10° 10' 10 ! !0 : 10" 

SCD40L + 
Indomethacin 



a 



10' 10 ! 10' 10' 10* 



120 

100 

- 80 

m 60 

oo 

Q 

u 40 

20 




I None 
iiii NS398 
—I Indomethacin 



t 



I-MDC 



sCD40L 



sCD40L/IFN 



SCD40L + IFN-y 
+ NS398 



Figure 3-5. Endogenous prostaglandins regulate CD83 in M-MDC matured 
with sCD40L and IFN-y. (A) Flow cytometric analysis of CD83 in I-MDC 
and M-MDC matured with sCD40L alone with our without Indomethacin, and 
with sCD40L/ IFN-y in the presence or absence of NS398. (B) Bar graph 
displays comparison of the median fluorescence intensity (MFI) in I-MDC 
and M-MDC matured with sCD40L alone and sCD40L/ IFN-y in the presence 
or absence of NS398 or Indomethacin. These results are representative of 
four independent experiments. 



39 



Prostanoids produced by MDC are, however, not without affect on MDC 
maturation. Blocking COX-2 with NS-398 profoundly inhibited CD83 expression 
following sCD40L/IFN-y stimulation (Figure 3-5). The predominant effect of 
prostanoids appears to be mediated through COX-2, as the addition of indomethacin did 
not enhance this effect (data not shown). When MDC were stimulated with sCD40L 
alone, substantially lower levels of CD83 expression were achieved. Since MDC 
stimulated in this manner produce PGE2 primarily through COX-1 we blocked 
prostaglandin production with indomethacin and evaluated CD83 expression. Unlike I- 
MDC matured with sCD40L and IFN-y, the COX inhibitor did little to affect CD83 
expression in these conditions. These data are consistent with the previous reports 
suggesting that PGE2 increases CD83 expression on MDC. However, these studies 
employed micromolar concentrations of PGE2 to enhance CD83 expression (Jonuleit et 
al, 1997). Although lower doses of PGE2 equivalent to that made by MDC were not 
tested in these reports, it may be that sCD40L provides a qualitatively different stimulus 
than LPS, TNF-a or a combination of inflammatory cytokines such that nanomolar levels 
of prostaglandins are effective. Based on the present findings, it appears that lower levels 
of endogenous prostaglandins uniquely stimulate expression of CD83 in contrast to other 
maturation antigens, e.g. CD86. 
Endogenous Prostanoid Production Affects Secretion of IL-12 

MDC secretion of the Thl polarizing cytokine, IL-12, has been extensively 
studied (Cella et al, 1996; Hilkens et al, 1996; Hilkens et al, 1997; Rieser et al, 1997; 
Snijders et al, 1996; Snijders et al, 1998). To examine the effect of endogenous 



40 



2500 -, E - 12 P 40 



2000 




B 

2000 -| IL-12p70 
1500 
1000 
500 







<30.8 <30.8 



I-MDC 



I-MDC 



c 

100000 



IL-12p40 




sCEMOL 



D 



2000 

1500 

1000 

500 





IL-12p70 



<30.8 <30.8 



sCD40L 



E 

150000 



100000 

50000 





IL-12p40 



« 

■ 



2000 -, IL-12p70 
1500 




SCD40L+IFN 



SCD40L+IFN 



None 
NS398 
^ Indomethacin 



Figure 3-6. Endogenous prostaglandins autoregulate IL-12p40 and IL-12p70 
production by I-MDC and M-MDC. Supernatants from I-MDC and M-MDC 
in the presence or absence of NS-398 or Indomethacin were analyzed for IL- 
1 2p40, IL- 1 2p70 by ELIS A. (A) IL- 1 2p40 in I-MDC, *p=0.045, (B) IL- 
12p70 in I-MDC, (C) IL-12p40 in MDC undergoing maturation with 
sCD40L, (D) IL-12p70 in MDC undergoing maturation with sCD40L (E) 
IL-12p40 in sCD40L/TPN-y matured MDC, *p =0.007 (F) IL-12p70 in 
sCD40L/IFN-y matured MDC, p=0.06. Conditions analyzed by paired t test. 



41 

prostaglandins on secretion of IL-12p40 and IL-12p70, MDC were prepared and assayed 
for both forms of this cytokine in the supernatants in the presence and absence of COX 
inhibitors. We chose to study IL-12 production during maturation of MDC using sCD40L 
alone, and in combination with IFN-y, the latter combination stimulating production of 
biologically active IL-12p70 (Hilkens et al, 1997). Consistent with previous reports, we 
found that I-MDC produced only IL-12p40 and did not produce IL-12p70 (Cella et al, 
1996; Snijders et al, 1996). When I-MDC were cultured in the presence of NS-398 for 
48 hours IL-12p40 levels were significantly reduced (Figure 3-6). The inhibition of IL-12 
by indomethacin was not different from that of NS-398, suggesting the effects of 
prostanoids on this cytokine are predominantly mediated by the COX-2 isoform. These 
results are consistent with those of Rieser et al. (1997) who showed an increase in total 
IL-12 when I-MDC are exposed to PGE2 or other compounds which increase 
intracellular cAMP (Rieser et al, 1997). In marked contrast, I-MDC undergoing 
maturation for 48 hours with sCD40L and IFN-y in the presence of COX-2 inhibitor, 
significantly increased IL-12p40 production (p=0.007) and increased, but not 
significantly, IL-12p70 production (p=0.068)(Figure 3-6). These findings mirror 
previous studies that showed that the addition of PGE2 to cell culture suppressed IL- 
12p70 production by maturing MDC (Snijders et al, 1996; van der Pouw Kraan et al., 
1995). Studies show PGE2 to be the predominant prostanoid suppressing IL-12 
production. Prostacyclin had similar but lesser effects than PGE2 on secretion of IL-12 
while TBX and metabolites PGD2 had little to no effect (Figure 3-7). Collectively, these 
data further demonstrate that prostanoids produced via COX-2 modulate MDC function 



42 



16000 
„ 14000 
*§ 12000 
© 10000 - 
*| 8000 
~£b 6000 - 



IL-12p40 




none C U SQ P 



none C U SQ P 



Immature MDC 



Maturing MDC 



Figure 3-7. Agonist/antagonist stimulation and IL-12 production in 
immature and maturing MDC. C=carbacyclin, prostacyclin agonist; 
U=U46619, thromboxane agonist; SQ=SQ29548, thromboxane antagonist; 
P=PGE2. Concentration of agonist/antagonist is 1 X 10" 6 M. IL-12 is 
expressed in pg/ml/1 X 10 6 cells. 



43 



1500 

1000 

500 





<20.8 <20.8 



I-MIX' 



B 




CD40L+IFN 



| None 

] NS398 
Z3 Indomethacin 



Figure 3-8. Endogenous prostaglandins do not significantly affect IL-10 
production in MDC. BL-10 production measure by direct ELISA in the 
presence or absence of COX inhibitors (A) I-MDC presence and absence of 
NS398, (B) sCD40L matured MDC with and without Indomethacin, (C) 
sCD40L/IFN-y matured MDC with and without NS398. No statistically 
differences noted using paired t test. 



44 

and markedly affect the secretion of IL-12. However, the effect is dependent on the state 

of differentiation of these cells. 

IL-10 Production by MDC is Not Regulated by Prostaglandin Synthesis 

Previous studies in murine macrophages demonstrated that IL-10 production in 
LPS stimulated macrophages occurred through a cAMP/PGE2 dependent mechanism 
(Strassmann et al, 1994). Therefore, the production of IL-10 in I-MDC and maturing 
MDC was evaluated. I-MDC do not produce detectable levels of IL-10 while M-MDC 
matured with soluble sCD40L alone or with and IFN-y produce low levels that are not 
significantly reduced with NS-398 or Indomethacin (Figure 3-8). These experiments do 
not suggest that prostaglandins produced by MDC stimulate IL-10 production. 
Furthermore, they demonstrate that prostaglandin mediated suppression of IL-12 in 
maturing MDC is mediated directly by endogenous PGE2 and not through its effect on 
IL-10. 
Prostaglandins Do Not Significantly Affect Antigen Uptake 

Finally, the ability of the maturing MDC to shut down antigen uptake in the 
presence and absence of endogenously produced prostaglandins as well as exogenously 
added PGE2 was measured by the MDC ability to uptake two fluorescent dyes. I-MDC 
express potent ability to uptake external molecules by two main mechanism, receptor- 
mediated endocytosis and macropinocytosis. Two fluorescent markers, FITC-Dextran 
(FD) and Lucifer Yellow (LY) measure receptor-mediated endocytosis and 
macropinocytosis, respectively. MDC that are mature decrease the ability to take up 
these markers thus reducing their antigen uptake. Figure 3-9 shows the reduce capacity 



45 



B. 




100 



[-MDC 




M-MDC (TNF) 




M-MDC (CD40L+IFN) 



Figure 3-9: Endogenous and exogenous prostaglandins do not significantly 
affect antigen uptake in MDC. (A) I-MDC (B) TNF-cc matured MDC (C) 
sCD40L and IFN-y matured MDC incubated with 1 ng/ml of FITC dextran at 
37oC for 1 hour in the presence or absence of NS398 or PGE2. MFI 
represents median fluorescence intensity. Similar results obtained with 
Lucifer yellow (data not shown). 



46 



of M-MDC to take up FD (the higher the MFI the higher the antigen uptake) and that 
endogenously produced prostaglandins as well as exogenously added PGE2 has no affect 
on the maturing MDC to shut down the antigen uptake machinery. 

Discussion 

This is the first report demonstrating that I-MDC and M-MDC constitutively 
express both cyclooxygenases, COX-1, and the normally inducible COX-2, and 
synthesize nanomolar quantities of PGE2. The predominant isoform of COX utilized to 
produce prostanoids by I-MDC is COX-2. An interesting finding of this study was that 
when I-MDC undergo maturation with sCD40L alone, PGE2 synthesis proceeds through 
COX-1 . In contrast, MDC stimulated with sCD40L in combination with IFN-y leads to 
higher levels of PGE2, but production reverts back to the COX-2 pathway. The 
observation that prostaglandin synthesis fluctuates from one COX isoform to the other is 
not a novel finding. Previous studies demonstrated that this phenomena occurs as a 
consequence of the coupling of COX isoforms to distinct PLA2 isoenzymes, e.g. 
cytoplasmic PLA2 to COX-2, and linkage of apparently discrete pools of AA to either 
COX-1 or COX-2 (Reddy et al, 1997b). Supporting these published studies, mouse 
macrophages expressing both COX-1 and COX-2 produce PGE2 only through COX-1 
when AA added to cultures, whereas IFN-y stimulates only COX-2 mediated 
prostaglandin synthesis. 

The regulation of COX-2 expression in MDC is unlike that of the precursor 
monocyte population as this cell is highly resistant to suppression by the anti- 
inflammatory cytokine IL-4 and IL-10. The reason for the marked alteration in COX-2 



47 

regulation is not apparent but may be related to the continuous presence of GM-CSF in 
vitro. Another possibility is that long-term culture or long-term exposure to IL-4 may also 
diminish the MDC response to this cytokine. Alternatively, studies have demonstrated 
that freshly isolated monocytes were more responsive to IL-4 induced TNF- 
a suppression than macrophages cultured for 7 days (Hart et al, 1995). These studies 
conclude that monocyte responses to immunoregulatory cytokines such as IL-4 may not 
mirror responses by their differentiated or activated counterparts (Hart et al., 1995). This 
suggestion is also supported by the studies of Maloney et al. (1998) in which neutrophil 
expression of COX-2 was likewise found resistant to IL-4, IL-10 and 11-13 (Maloney et 
al., 1998). Therefore, the pathway of myeloid differentiation or maturation may dictate 
the responsiveness of COX-2 to anti-inflammatory cytokines. 

The production of prostaglandins appears to autoregulate some aspects of MDC 
maturation, e.g. CD83, and function, e.g. IL-12 production by MDC. These finding show 
that endogenous prostanoids generated through COX-2 in vitro do not interfere with the 
expression of HLA-DR and co-stimulatory molecules on I-MDC. This result was 
expected since previous studies showed that less that 10" 9 M PGE2 had little effect on 
these differentiation antigens for MDC. Although endogenous production of prostanoids 
does not modify HLA-DR or the co-stimulatory molecules CD40, CD80, and CD86, 
COX-2 produced prostanoids do markedly modulate the expression of the maturation 
antigen, CD83, in sCD40L/IFN-y stimulated MDC. It appears that the threshold for 
prostanoid regulation of CD83 differs markedly from that of HLA-DR and co-stimulatory 
molecules. In the case of co-stimulatory molecules, cells producing higher levels of 



48 

PGE2 than MDC, perhaps macrophages, within the local environment may be required to 
affect the upregulation of these molecules as previously described (Jonuleit et al., 1997). 

In this study, a divergent regulation of IL-12 by COX-2 mediated prostanoid 
production is described. It demonstrates that endogenously produced prostaglandins 
increase the IL-12p40 in I-MDC but do not stimulate IL-12p70 production. This 
prostanoid-mediated enhancement of IL-12p40 production by I-MDC may serve to limit 
the Thl immune response as IL-12 p40 homodimers function as a receptor antagonist 
(Ling et al, 1995; Mattner et al, 1993). As MDC mature in the presence of IFN-y the 
level of COX-2-mediated prostanoid production increases, which effectively suppresses 
IL-12p70 and p40. This is in agreement with studies of others demonstrating that 
addition of PGE2 to cell culture reduces IL-12 production by M-MDC (van der Pouw 
Kraan et al, 1995; 1996). Thus, endogenous prostanoids appear to play an important role 
in limiting the capacity of M- MDC to become a potent Thl promoting antigen 
presenting cells by down regulating the production of biologically active IL-12p70 these 
cells. The mechanism responsible for the interesting divergence in prostanoid-mediated 
regulation of IL-12 has not been defined. However, modulation of surface or nuclear 
receptors for PGE2, e.g. EP1, EP2, EP3 or EP4 could be responsible for these changes in 
the response of MDC as they mature. Preliminary studies indeed suggest (Chapter 4) that 
the maturation stimuli regulate EP receptors expression and this defines the response of 
MDC to PGE2. 

Previous reports have suggested that COX-2 is important for high level 
production of prostanoids by particular cells types and is the form of the enzyme 
associated with inflammation. It is of interest that when MDC are exposed to IFN-y in 



49 

culture that PGE2 production is enhanced and that COX-2 is the predominant isoform of 
the enzyme used to produce prostanoids. These findings suggest that a default setting for 
I-MDC and maturing MDC is to increase COX-2 mediated PGE2 production when 
involved in inflammation, when acting as an antigen presenting cell for established Thl 
responses, or when encountering other IFN-y producing cells, e.g. NK or NK T cells. 
Under these circumstances, MDC are thus programmed, via COX-2 expression, to 
suppress IL-12 production and thus autoregulate its capacity to further stimulate Thl T 
cells. 

Prostaglandin production by MDC appears to play an important and focused role 
in the function of MDC. From the findings of this study it appears that MDC tend to 
produce lower levels of PGE2 than produced by monocytes or macrophages. The lower 
level of prostaglandins produced by MDC may be of a practical importance as that these 
lipid molecules work in an autocrine fashion modulating MDC function, and perhaps in 
regulating T cells within their microenviroment in a paracrine fashion. Working in this 
manner the effects of prostanoids would be contained and limit the untoward effects of 
these molecules. In this context, determining the regulation of the prostanoid receptors on 
MDC and T cells thus becomes critical to understanding the effects of these lipid 
molecules on their target cells. Furthermore, the production of prostaglandin by MDC 
may provide these cells with a self-contained "signal 3" as proposed by Kalinski et al. 
(1999) which would polarize the MDC away from stimulating Thl responses, perhaps 
more toward a Th2 promoting antigen presenting cell (Kalinski et al., 1999a). These 
findings also have important implications regarding the effects of COX inhibitors, 
particularly the new class of COX-2 specific drugs, on the immune response. The potent 



50 



anti-inflammatory action of these drugs may in part be limiting MDC maturation. These 
studies also raise a potential concern regarding the possibility that COX-2 specific drugs 
could potentiate Thl responses by removing the suppressive effects of prostaglandins on 
IL-12 production by M-MDC. Further study in vivo is required to establish the effect of 
these drugs on the biology of MDC. 



CHAPTER 4 

MATURATION STIMULI AND MODULATION OF PROSTAGLANDIN 

RECEPTORS REGULATE THE EFFECTS OF PGE2 ON INTERLEUKIN-12 

PRODUCTION BY MONOCYTE DERIVED DENDRITIC CELLS 



Review of Literature 

Dendritic cells (DC) are potent antigen presenting cells that express high levels of 
MHC and B7 molecules and readily activate T cells. Following interaction with CD40L 
expressed on T cells, DC undergo maturation further up-regulate MHC and B7 molecules 
and initiate production of the cytokine IL-12p70 (Cella et al., 1996). This cytokine is 
composed of covalently linked p40 and p35 subunits and is central to the development of 
a Thl immune response (Trinchieri and Gerosa, 1996). However, when DC are resting 
or in an immature state, they secrete only IL-12p40 as a homodimer or monomer that 
functions as an IL-12p70 antagonist (Ling et al, 1995; Mattner et al, 1993). Thus, the 
capacity to regulate DC production of IL-12p70 and p40 is critical to controlling the 
development of Thl responses important for inflammation, transplant rejection and many 
autoimmune diseases (Sutterwala and Mosser, 1999). 

Prostaglandins have been identified as potent regulators of IL-12 production by 
monocyte-derived DC (MDC) (Rieser et al, 1997; van der Pouw Kraan et al., 1995; 
1996). Rieser et al. showed that addition of exogenous PGE2 to MDC cultures or the 
addition of compounds increasing cAMP increased total IL-12 secretion (IL-12p40) in 
immature MDC (Rieser et al, 1997). However, when MDC are undergoing maturation, 
prostaglandins and cAMP analogues (N6,02'-dibutyryl adenosine-3',5'-cyclic 

51 



52 

monophosphate) inhibit production of both IL-12p70 and p40 (van der Pouw Kraan et al., 
1995; 1996). In addition, the previous chapter indicates endogenous prostaglandin 
production by MDC stimulates immature (I-) MDC cells to produce IL-12p40 while 
suppressing IL-12p40 and p70 production by maturing MDC (Chapter 3). However, 
when MDC are fully mature, the production of IL-12p70 and p40 becomes resistant to 
the regulatory effects of PGE2. These studies suggest that activation/maturation of MDC 
causes a functional transition with regard to the action of prostaglandins on IL-12 
production (Kalinski et al., 1999). The factors responsible for this transition remain 
largely undefined. 

A potential etiology for the change in response of MDC to prostaglandins could 
be modulation of its prostaglandin receptor as these cells mature. PGE2 mediates a wide 
variety of cellular responses by binding to a diverse repertoire of prostaglandin receptor 
subtypes on nuclear and cellular membranes. PGE2 receptors (EP1, 2, 3, 4) are members 
of the seven transmembrane rhodopsin-type G protein coupled receptors and are 
pharmacologically defined. EP1 is linked to an unidentified G protein and uses Ca^ as a 
second messenger. EP2 and EP4 receptors are coupled to a G-protein (Gs) that signals by 
stimulation of adenylate cyclase and increases in cAMP. Seven different isoforms of EP3 
resulting from splice variants in the carboxyl terminals have been described. The major 
effect of signaling through the EP3 is the inhibition of adenylate cyclase and decreases in 
cAMP, although one isoform of this receptor increases cAMP and another mediates 
responses through inositol triphosphate (Narumiya et al, 1999). 

Although the effects of PGE2 on the immune response have been widely studied, 
studies examining the expression of these receptors in cells of the immune system are 



53 

limited. EP4 was recently shown to upregulated in THP-1 cells with stimulation by 
phorbol esters (Mori et al, 1996). Eriksen et al. (1985) described the prostaglandin E2 
receptors on human peripheral blood monocytes (Kd= 1.1X10" M and 240 sites per 
cell) but did not characterize the subtypes of EP receptors on these cells (Eriksen et al, 
1985). Functionally, Meja, Barnes and Giembycz (1997) showed that either EP2 or EP4 
contributed to the inhibition of LPS stimulated TNF-a production in human blood 
monocytes (Meja et al., 1997). There is, however, no report of the prostaglandin receptor 
expression on MDC. 

In order to determine if modulation of EP receptors was responsible for the drastic 
changes in PGE2 mediated regulation of IL-12 in MDC, this study examines EP receptor 
expression at distinct states of maturation (I-MDC, maturing MDC, and M-MDC). The 
importance of these aspects of MDC IL-12 regulation by prostaglandins is discussed. 

Materials and Methods 
Materials 

PGE2, Butaprost, 11-deoxyPGEl, 19-hydroxyPGE2, Sulprostone, AH6809, and 
SQ29548 were purchased from Cayman Chemical (Ann Arbor MI). AH23848B was a 
gift from Glaxo Wellcome (United Kingdom). Forskolin, 3-isobutyl-a-methylxanthine 
(IBMX) and N6,02'-dibutyryl adenosine-3',5'-cyclic monophosphate (db-cAMP) were 
purchased from Calbiochem (San Diego, CA). 
Isolation of Monocytes and Dendritic Cell Culture Conditions 

PBMC were isolated from buffy coats from one unit of whole human blood using 
Histopaque Ficoll (Sigma, 1 .077, endotoxin tested, St. Louis, MO). Cells were washed 
two times with Dulbecco's PBS (DPBS), Ca++ and Mg++ free (Cellgro, endotoxin 



54 

tested) and resuspended in RPMI 1640 media with L-glutamine (Gibco, BRL, Grand 
Island, NY) supplemented with 10% fetal calf serum (Hyclone, endotoxin tested, Logan, 
UT), and 1% streptomycin, penicillin, neomycin (Sigma). PBMC were allowed to adhere 
for 2 hours at 37°C, 5% C02, 100% humidity and non-adherent cells were washed away 
with DPBS. Complete RPMI tested negative for endotoxin (<2.0 EU/ml) (E-Toxate Kit, 
Sigma). Adherent cells were cultured in complete RPMI supplement with 500 U (50 
ng/ml) GM-CSF (Endogen, Woburn, MA) and 500-1000 U IL-4 (R&D Systems, 
Minneapolis, MN) to generate I-MDC. To generate M-MDC, day 6 1-MDC were 
harvested, washed and replated at 3.0 X 105 cells/ml and supplemented with lug/ml 
sCD40L (gift from Immunex, Seattle WA), and/or 1000 U of human recombinant IFN-y 
(Endogen, Boston, MA). Some cultures were supplemented with NS-398 (Cayman 
Chemical), a specific COX-2 inhibitor, or indomethacin (Sigma), a COX-1 and COX-2 
inhibitor. 
Isolation of Total RNA and Reverse Transcription 

On Day 6 I-MDC were stimulated with the maturation stimulus listed above and 
harvested at various time points from 2 hours to 48 hours. After stimulation, MDC were 
washed with PBS and immediately frozen at -70° C. Total RNA was extracted using the 
High Pure Total RNA isolation kit (Boeringer Mannhiem, Indianapolis, IN) that contains 
a DNAase treatment step. Total RNA quantity was determined by UV spectrophotometry 
at 260 nm. First stand cDNA was synthesized from 250 ng of total RNA with a 
combination of oligo dT and random hexamers (Perkin Elmer, Branchburg, NJ ) with 
Superscript II reverse transcriptase (Gibco-BRL, Life Technologies, Grand Island, NY). 



55 

Relative Polymerase Chain Reaction (PCR) 

A constant volume of the reverse transcriptase reaction (1 ul) was used in a 
relative semi-quantitative PCR using P-actin as internal standard control. Because the 
message for the EP receptors is rare in comparison to P-actin, primer competitors to p- 
actin were used to ensure that amplification of the endogenous standard (P-actin) was in 
the same linear range as the target mRNA for EP receptors. We found that a ratio of 3:7 
P-actin primers: P-actin competitors and 30 cycles of PCR was sufficient to yield similar 
linearity to the mRNA for the EP receptors. The PCR protocol was 30 cycles of 0.5 min 
at 94°C, 0.5 min at 58°C, and 0.5 min at 72°C. The primers used were as follows (size of 
base pairs in parenthesis): EP1 (407):5'CTTCTTGGCGGCTCTCGG. 3' 
AGGGTGGGCTGGCTTAGTC, EP2 (394):5'GCTGCTGCTTCTCATTGTCTCG, 
3TCCGACACCAGAGGACTGAACG , EP3 (366):5' ACCCGCCTCAACCACTCCT, 
3' CCGAAAAAGGTGCAGAGCC, EP4 (334): 5' GGTCATCTTACTCATTGCCACC, 
3' AGATGAAGGAGCGAGAGTGG, p-actin (638):5' ATCTGGCACCACACCTTCTA, 
3' GTGTTGGCGTACAGGTCTTT, competititor p-actin: 

5ATCTGGCACCACACCTTCTAAGT, 3* GTGTTGGCGTACAGGTCTTTATT (EP2 
and EP4 primers (Mukhopadhyay et ah, 1999)). PCR products were resolved on a 2% 
agarose (FMC Bioproducts, Rockland, MN) gel with ethidium bromide added (Gibco). 
Bands were quantitated by Stratagene Eagle Eye. 
IL-12p40 and IL-12p70 Assays 

MDC culture supernatants from various conditions were analyzed for IL-12p70 
and IL-12p40 (gift from Dr. Maurice Gately, Hoffrnan Roche, Nutely, NJ), by ELISA as 
previously described (Gately, 1999). IL-12 was standardized to pg/ml/1 X 10 6 cells. 



56 

Measurement of cAMP Formation 

The cAMP level was determined by total cAMP determination kit (Amersham). 
Briefly, I-MDC or M-MDC were cultured at 5 X 10 5 cells/ ml in 96 well plates. Cells 
were incubated at 37° C for 30 minutes in complete RPMI supplemented with 5 uM 
NS398 and 10 uM IBMX. Cells were stimulated for 5 minutes with various 
agonist/antagonist to the prostaglandin receptors. After 5 minutes, cells were lysed with 
lysing solution provided with the kit and total cAMP by indirect ELISA was determined. 
cAMP is reported in pmol/ 1 X 10 5 cells. 
Quantitation of 3 H-PGE2 Binding on I- and M- MDC 

Saturation binding studies were performed as previously described (Zeng et ai, 
1998). Briefly, 5 X 10 5 MDC were suspended in 100 ul of binding buffer in GF/C 
microtiter plates (Millipore, Bedford, MA) and incubated at 4° C for 1 hour with various 
concentration (0-3 OnM) of 3 H-PGE2 (Amersham). Plates were washed ten times with ice 
cold buffer to remove non-specific binding. Filtered plates were allowed to dry for 2-24 
hours and then 25 ul of scintillation fluid was added and radioactivity counted (1450 
Microbeta Wallace, Trilux liquid scintillation counter, 58% efficiency). Specific binding 
was calculated by subtraction of nonspecific binding, suspensions containing 10' 5 M 
unlabelled PGE2 (Cayman Chemical) for each concentration of 3 H PGE2. Saturation 
data were analyzed by PrismGraphpad. Competitive binding studies were performed 
exactly the same as described above except 10" 9 M -lO^M of unlabelled selective agonists 
were employed. 



57 

Results 
PGE2 Regulates IL-12 in I-MDC Through EP2 and EP4 Receptors 

I-MDC were cultured with defined concentrations of PGE2 and secretion of IL- 
12p40 and IL-12 p70 were analyzed by ELISA after 48 hours. Because we previously 
showed that MDC produce endogenous prostaglandins, particularly PGE2, we performed 
this experiment in the presence of a cyclooxygenase-2 (COX-2) specific inhibitor, NS- 
398. As seen in Figure 4- la, the cyclooxygenase-2 specific inhibitor NS-398 decreases 
IL-12p40 production by I-MDC and replacement with nanomolar concentrations of 
PGE2, equivalent to the level of prostaglandin produced spontaneously by these cells, 
restores IL-12p40 production to baseline. As reported, we found that I-MDC do not 
produce IL-12p70. However, I-MDC do produce IL-12p40 which is increased in a dose 
dependent fashion when these cells are cultured in increasing concentrations of PGE2 
(Figure 4- la). Previous reports suggested that PGE2 stimulates IL-12 production through 
the activation of adenylate cyclase (Rieser et ah, 1997). Indeed, this experiment shows 
PGE2 readily stimulates cAMP in I-MDC (Figure 4- lb.). In addition, when I-MDC are 
cultured with db-cAMP, IL-12 p40 secretion is increased to a similar degree as with 
10" 6 M PGE2 (figure 4-lc; 2 and 3). These results suggested that EP receptors that 
increase cAMP, most likely EP2 and/or EP4, may play a role in regulation of IL-12p40 
production. To evaluate this possibility we assessed the effects of EP2, EP2/4 and EP3 
specific agonists on IL-12 production in vitro. At the present time no EP1 or EP4 specific 
agonists are available. We find that the EP3 agonist had no effect on IL-12p40 production 
(Figure 4-lc;4). However, agonists that stimulate either the EP2 receptor (butaprost and 
19-hydroxy PGE2) or both EP2 and EP4 (1 ldeoxy PGE1) stimulate IL-12p40 production 



58 




NS PGE2 PGE2 PGE2 PGE2 
10-»M 10-*M 10- 7 M 10*M 





& 



0" 



^ 



# 
& 



1 


None 


2 


PGE2 


3 


db-cAMP 


4 


Sulprostone 


5 


11deoxyPGE1 


6 


19-hydroxyPGE2 


7 


Butaprost 


8 


AH23848 + Butaprost 


9 


AH6809 + Butaprost 



Figure 4-1 : IL-12 and cAMP production after stimulation with PGE2 or 
prostaglandin receptor agonist in immature monocyte derived dendritic 
cells. (A) Immature-MDC were stimulated 48 hours with increasing doses 
of PGE2 in the presence of NS398, a specific COX-2 inhibitor. 
Supernatants were harvested after 48 hours and IL-12p40 and IL-12p70 
measured. IL-12p40 expressed in pg/ml/1 X 10 6 cells. No EL-12p70 
detected. (B) Total cAMP production measured in I-MDC in the presence 
of NS398 and EBMX, a PDE inhibitor, after 5 minute stimulation. Total 
cAMP reported in fmol/1 X 10 5 cells. (C) IL-12 production in I-MDC after 
48 hours with the agonist/antagonist 1-9: Sulprostone, EP1/EP3 agonist; 
1 IdeoxyPGEl, EP2/EP4 agonist; 19hydroxyPGE2 and Butaprost, EP2 
agonist; AH23848, EP4 antagonist; and AH6809, EP2 antagonist. Data are 
representative of at least three experiments and are presented as fold 
changes from baseline of no agonist/antagonist added. 



59 

(Figure 4-lc; 5-7). Butaprost stimulation achieves approximately 60% of the IL-12p40 
levels stimulated by PGE2 and the specificity is demonstrated by the EP2 specific 
antagonist AH6089 that totally blocks this effect. The addition of the EP2/4 agonist 
1 ldeoxy PGE1 stimulates levels of this cytokine nearly identical to that of PGE2. These 
results suggest that both EP2 and EP4 receptors are involved in mediating the effects of 
PGE2 on IL-12p40 production with the EP2 receptor mediating the majority of the 
effects of PGE2 on IL-12 production in I-MDC. 

Because antibodies are not available to human EP receptors, mRNA expression of 
these receptors on I-MDC was performed by a semi-quantitative competitive RT-PCR 
assay using primer sequences for human EP1, 2, 3, and 4 (Mukhopadhyay et al., 1999). 
I-MDC do not express mRNA for EP1 and express very low levels of transcript for EP3 
receptors (data not shown). I-MDC predominantly express mRNA for EP2 with lower 
levels of EP4 message detected (Figure 4-2). 

To evaluate the expression of the PGE2 receptors on I-MDC, saturation binding 
studies using 0-30 nM 3 H-PGE2 in the presence and absence of 1000-fold excess of 
unlabeled PGE2 was employed. Figure 4-3a shows the saturation binding curves and 
Figure 4-3b, the Scatchard transformation of the saturation binding data using Graphpad 
Prism software. These studies reveal that I-MDC express 1087 binding sites per cell with 
a Kd=3.2X10" 10 M. To determine the relative expression of EP receptor subtypes on I- 
MDC, competitive binding assays employing 3 H-PGE2 and unlabeled EP specific 
agonists were performed. As seen in Figure 4-3c-f, 3 H-PGE2 is not displaced by 
SQ29548, a thromboxane agonist and a negative control for EP receptor binding. 
However, 1 ldeoxy PGE1, a combined EP2/4 agonist, displaces almost 100% of PGE2 



60 



B 





Immature MDC 



Figure 4-2: EP2 and EP4 mRNA production in immature monocyte derived 
dendritic cells. RT-PCR performed on day 6, 1-MDC by semi-quantitative, 
relative PCR exactly as described in Materials and Methods. (A) P actin (638 
base pairs) and EP2 (394 base pairs). (B) p actin (638 base pairs) and EP4 
(334 base pairs). (C) Graphic representation of ratio of EP2 and EP4 to P actin 
as quantitated by band density on Stratagen Eagle Eye. 



61 

binding at lO^M, while butaprost, an EP2 specific agonist, competes with PGE2 
displacing over 60% of this ligand at a concentration of 10 4 M. Finally, sulprostone, an 
EP1/ EP3 agonist, displaced little PGE2 in these studies. These binding studies are 
consistent with data from the RT-PCR and EP2, EP2/4 and EP3 agonist studies and 
suggest that I-MDC express predominantly EP2 and EP4 receptors that mediate the 
effects of PGE2 on IL-12p40 production. 

EP2 Receptors Mediate the Suppressive Effects of PGE2 on IL-12p70 Production by 
Maturing MDC 

Studies by our laboratory and others (Hilkens et al., 1997) suggested that I-MDC 
undergoing maturation with CD40L/IFN-y produce IL-12p70 and p40, however, in 
contrast to I-MDC, PGE2 now suppresses production of both molecules. In order to 
establish whether modulation of EP receptors is responsible for the switch in the effect of 
prostaglandins, we repeated the RT-PCR analysis of EP receptors and agonist studies as 
described above. First, various specific agonists were added to the culture of maturing 
MDC and IL-12p70 and IL-12p40 was measured in the supernatants. IL-12p70 (Figure 
4-4) and IL-12p40 (data not shown) were completely suppressed by EP2 agonists and this 
effect was blocked by the addition of the EP2 antagonist (see figure 4-4, 6-9). These data 
strongly argue that the EP2 receptor is dominant in regulating IL-12 production in 
maturing MDC. To assess EP receptor expression in maturing MDC, I-MDC were 
cultured in the presence of CD40L and IFN-y and harvested mRNA at 2, 4, 24 and 48 
hours and relative RT-PCR performed. Again, we could not detect mRNA expression for 
EP1 and only low levels of EP3 receptor transcripts were detected in maturing MDC at 
any of the time points analyzed (data not shown). However, EP2 mRNA expression 



62 



A. 



200 



150 



.100 




B 



10 20 30 

concentration of 3H PGE2 (nM) 



40 



0.12 - 








^"N? 




8 uu ° " 




UJ 

s 






PL, 

X 

1 

o 

13 
u 

tg 

u 

s. 

CO 




\. ♦ 


- 
( 




) 500 

Bound 


1000 




120 

too 

80 
60 

40 

20 





10"» 10* 10- 7 lO" 6 10- 5 1CH 




♦ Sulprostone 
*PGE2 



10- 9 10" 8 10- 7 10- 6 10- 5 




10-* 10 s lO" 7 10-* lO" 5 io-« 



Figure 4-3: Saturation binding curves, Scatchard analysis, and competitive 
displacement in I-MDC. (A) Specific binding of 3H PGE2 to I-MDC. 
Specific binding calculated by subtracting non-specific binding, 3H PGE 
bound with 1000 fold excess of unlabeled PGE2, from total binding. (B) 
Scatchard transformation of saturation binding curve by GraphPad Prism. 
Bmax = 1076 sites per cells, Kd=3.2 X 10" 10 M. Data are respresentative of 
three donors. Competitive displacement of specific 3H PGE2 binding (C) 
1 IdeoxyPGEl, EP2/EP4 agonist (D) Butaprost, EP2 agonist (E) sulprostone, 
EP1/EP3 agonist and (F) SQ29548, Thromboxane receptor agonist used as a 
negative control. 



63 

declined 50% over a period of 24 hours from that of the baseline I-MDC. Meanwhile, 
transcripts for EP4 increased rapidly within hours of stimulation and peaked almost three- 
fold above baseline at 48 hours of culture when the MDC is fully mature (Figure 4-4b-d). 
The dominance of the EP2 receptor control of IL-12p70 production was difficult to 
reconcile with the EP2 receptor mRNA data as it was substantially reduced during the 
culture period. We evaluated the possibility that the addition of PGE2 sustains the 
mRNA expression of the EP2 receptor. However, the RT-PCR analysis for the EP2 
receptors following culture in PGE2 did not substantiate this (data not shown). These 
findings may be reconciled, however, if EP2 receptors are stable despite decreased 
transcription. Another explanation may reside in the fact that over 75% of IL-12p70 is 
produced within the first 24 hours of culture by maturing MDC (Figure 4-4e). Therefore, 
the presence of higher levels of the EP2 receptors early in the culture period is critical. 
These studies suggest that there are changes in the dominance of EP receptor, with the 
EP2 receptor playing the major role in maturing MDC while both EP2 and EP4 are 
important for I-MDC. However, the regulatory outcomes of PGE2 on IL-12 (e.g. up- 
regulation in I-MDC with down-regulation in maturing MDC) are largely governed by 
the maturation stimulus or by molecular changes that occur as a result of maturation. 
Fully Mature MDC Express EP4 Receptors But IL-12 Production is Insensitive to 
the Regulatory Effects of PGE2 and cAMP 

Because IL-12p70 production by M-MDC is reported to be resistant to the effects 
of PGE2, the regulation of this cytokine by EP specific agonists was evaluated. M-MDC 
were generated from I-MDC after 48 hours of culture with CD40L/IFN-y. For the next 
48 hours these cells were exposed to the same series of EP agonists as were immature and 



64 



B 




1 


None 


2 


PGE2 


3 


db-cAMP 


4 


Sulprostone 


5 


11deoxyPGE1 


6 


19-hydroxyPGE2 


7 


Butaprost 


8 


AH23848 + Butaprost 


9 


AH6809 + Butaprost 



D 




Hours 



Hours 

1.2 



24 48 



■1 * 
a o.8 

PQ 

o 0.6 

I 0.4 

0.2 






EP2 
EP4 



20 40 

Hours 



60 



5000 



c 4(K)0 




Figure 4-4: IL-12p70secretion and mRNA expression of EP2 and EP4 
by relative RT-PCR in I-MDC matured with sCD40L and IFN-y. (A) 
Immature-MDC were stimulated with sCD40L and IFN-y in the presence 
of NS398 and various agonist listed 2-9. Forty-eight hours after 
stimulation, IL-12p70 and IL-12 p40 were measured (IL-12p40 gave 
similar pattern of results, data not shown). Data are representative of at 
least three donors and presented as fold changes from sample with no 
agonist/antagonist added. Semiquantiative RT-PCR with P actin as 
internal standard (638 base pairs) at 0, 4, 24, and 48 hours (B) EP2 
(lower band 394 base pairs) (C) EP4 (lower band 334 base pairs). (D) 
Graphic representation of EP2 and EP4 mRNA ratio to P actin mRNA 
over a 48 hour period. (E) IL-12p70 production measured at identical 
time points and expressed in pg/ml/ 1 X 10 6 cells. 



65 

maturing MDC. In stark contrast to the previous studies with less mature MDC, the fully 
mature MDC were insensitive to PGE2, EP2, EP3 and EP2/4 agonists (Figure 4-5a;5-7.). 
Additional studies indicated that these cells produced little cAMP in response to PGE2 or 
even forskolin (Figure 4-5b) suggesting a modification of EP receptors, adenylate cyclase 
activity or an increase in phosphodiesterase (PDE) activity. The latter would not appear 
to be the cause since IBMX, a global PDE inhibitor was present throughout the cAMP 
experiments. 

To evaluate EP receptor expression on the fully mature MDC, once again RT- 
PCR for the EP receptors and binding studies were performed to determine cell surface 
receptor density and subtypes. Analysis of EP receptor mRNA expression indicated a 
marked upregulation of EP4 message in comparison to I-MDC and a down-regulation of 
EP2 message (Figure 4-4; 48 hour time point). Again, very low levels of transcripts for 
EP3 were found and EP1 was not expressed. Binding studies indicated that fully matured 
MDC express 30% fewer EP receptors than do I-MDC and have a K<i of 7.7 X 10' 10 M 
(Figure 4-6a). Competitive binding studies suggest that the EP2 receptor is substantially 
reduced and that of EP4 is increased (Figure 4-6c-f)- These changes in 
EP receptor expression could account for some of the reduced generation of cAMP as the 
EP2 receptors stimulates larger cAMP increases in comparison to EP4 receptors. In 
addition, we found a minimal response to forskolin (see figure 4-5a) suggesting 
decreased adenylate cyclase activity, or enhanced phosphodiesterase activity in fully 
mature MDC as a contributing cause for reduced cAMP generation. Finally, 
compounding the effects of receptor modulation and reduced capacity to generate cAMP, 
these experiment show that fully mature MDC IL-12 production was insensitive to db- 



66 



B 




2 3 


4 5 6 7 8 


1 


None 


2 


PGE2 


3 


db-cAMP 


4 


Sulprostone 


5 


11deoxyPGE1 


6 


19-hydroxyPGE2 


7 


Butaprost 


8 


AH23848 + Butaprost 


9 


AH6809 + Butaprost 



a iooo 



a 750 



250 



■ III 



* 



/ 



Figure 4-5: IL-12 and cAMP production in fully mature MDC after 
stimulation with prostaglandin receptor agonist. Day 6 1-MDC were 
stimulated with sCD40L and IFN-g for 48 hours. M-MDC were harvested, 
washed, replated and restimulated with sCD40L/IFN-y and the various 
agonist/antagonist 2-9. Data are representative of at least three donors and 
presented as fold changes in IL-12p70 levels from baseline (no 
agonist/antagonist added). (B) Total cAMP was measured in MDC 
matured for 48 hours in sCD40L and IFN-y stimulated for 5 minutes with 
PGE2, sulprostone, or forskolin in the presence of NS-398 and IBMX. 
cAMP is reported in fmol/1 X 10 5 cells. 



67 




B. 



10 20 30 

concentration of 3H PGE2 (nM) 



40 




(N 

O 



-a 
a 

=3 
O 



at 

o 

'o 

a. 




10-' 10* 10- 7 10* 10- 5 1(H 

Figure 4-6: Saturation binding curves, Scatchard analysis, and competitive 
displacement inM-MDC. (A) Specific binding of 3HPGE2 to I-MDC. Specific 
binding calculated by subtracting non-specific binding, 3H PGE bound with 1000 
fold excess of unlabeled PGE2, from total binding. (B) Scatchard transformation 
of saturation binding curve by GraphPad Prism. Bmax = 766 sites per cells, 
Kd=7.7 X 10" 10 M. Competitive displacement of specific 3H PGE2 binding (C) 
1 IdeoxyPGEl, EP2/EP4 agonist (D) Butaprost, EP2 agonist (E) sulprostone, 
EP1/EP3 agonist and (F) SQ29548, Thromboxane receptor agonist used as a 
negative control. 



68 

cAMP (see figure 5a). These data suggest a series of modifications in components of the 
regulatory signaling pathway used by PGE2 (e.g. receptor expression, cAMP generation 
or stability, and cAMP sensitivity). 

Discussion 
These studies clearly point out differential regulation of IL-12 in MDC by 
prostaglandins at three distinct phases of their development, I-MDC, MDC undergoing 
maturation and fully M-MDC. They also for the first time characterize EP receptor by 
mRNA expression, prostaglandin binding and modulation of these receptors during the 
maturation of MDC. Collectively, these data provide a more complete understanding as 
to: 1) which EP receptors regulate IL-12 production, 2) how the divergent regulatory 
effects of PGE2 on IL-12 production are partially dictated by the dominant effect of EP2 
receptors, 3) how modifications in several components of PGE2 signaling pathways 
ensure resistance of IL-12 to this eicosanoid or other compounds that increase cAMP, 
and 4) how the maturation stimulus ultimately governs the effect of prostaglandins on IL- 
12 production. 

This study demonstrates for the first time the repertoire of EP receptor expression 
on human I-MDC. Based on competitive displacement studies I-MDC express EP2> 
EP4»EP3 and these cells respond to PGE2 and EP2 and EP2/4 agonists by increasing 
the secretion of IL-12p40 with no IL-12p70 production. Stimulation of I-MDC with 
PGE2 or selective EP2 or EP2/4 agonists (data not shown) confirms that these 
eicosanoids utilize cAMP as a second messenger to mediate increases in IL-12p40. This 
is consistent with published results indicating that both EP2 and EP4 are G proteins that 
stimulate adenylate cyclase and increase cAMP (Blaschke et al., 1996). The results from 



69 

our study of I-MDC and IL-12 regulation are in complete agreement with Rieser et al. 
(1997) who found an increase in total IL-12 when I-MDC were stimulated with PGE2, 
forskolin, or db-cAMP (Rieser et al., 1997). The up-regulation of the IL-12p70 
antagonist, IL-12p40 by PGE2 suggests that the presence of these lipid mediators may 
initially limit the generation of Thl responses, or in pre-existing responses where I-MDC 
may be recruited, would limit this type of immune response. Recent publications indeed 
suggest that one of the actions of prostanoids is to down-regulate established 
inflammation (Betz and Fox, 1991 ; Snijdewint et al., 1993; van der Pouw Kraan et al., 
1995). 

The maturing MDC is complex with regard to PGE2 regulation of IL-12p70. The 
addition of 10^ M PGE2 from the inception of culture or when added up to four hours 
after application of the maturation stimulus completely suppresses IL-12p70 production 
by maturing MDC (Jonuleit et al., 1997; Kalinski et al, 1997). This study determined 
that PGE2 suppression of IL-12p70 is mediated through the EP2 receptor and its second 
messenger cAMP. This regulation is somewhat perplexing as transcripts for EP2 are 
down-regulated by 24 hours and the majority of EP2 binding is lost 48 hours after 
application of the maturation stimulus. However, we find that 75% of the IL-12p70 
produced by maturing MDC during a 48-hour culture is made in the first 24 hours. 
Therefore, the continued presence and function of EP2 receptors in the early culture 
period would be most critical for regulation of this cytokine. 

When fully mature, MDC become highly insensitive to the effects of PGE2. We 
found that maturation with CD40L/IFN-y modified M-MDC several components of the 
signaling pathway utilized by PGE2 to mediate suppression IL-12p70. First, this 



70 

maturation stimulus resulted in a decrease in mRNA for EP2 receptors while mRNA for 
EP4 receptor increased. In conjunction with these changes, PGE2 stimulation of M- 
MDC led to minimal increases in cAMP in comparison to much larger responses in I- 
MDC which express both EP2 and EP4 receptors. The limitation in cAMP production 
following PGE2 exposure in M-MDC may be explained by the modulation of EP2 and 4 
receptors as the latter produce lower levels of cAMP when stimulated by prostaglandin 
binding compared to EP2 receptors (Choung et al, 1998). Another explanation for 
decreased cAMP responses in M-MDC could be related to the described short-term 
agonist induced desensitization that occurs with the EP4 receptor (Bastepe and Ashby, 
1999; Nishigaki et al, 1998). In addition to these changes M-MDC also become 
insensitive to cAMP since db-cAMP no longer suppresses IL-12p70. The reasons for this 
loss of response have not been determined, but could be related to a loss of function of 
specific isoforms of protein kinase A. Overall, these data suggest several components of 
the prostaglandin signaling cascade are modified during maturation such that IL-12p70 
production is now highly protected from PGE2 or other compounds which generate 
cAMP down- regulation. This feature of M-MDC may help to maintain Thl immune 
responses until such time as these cells are removed or I-MDC replenish M-MDC and 
maturation stimuli. 

In conclusion, these studies further define how PGE2 exerts diverse effects on the 
regulation of IL-12 in MDC at various stages of development. Because IL-12 is critical 
for Thl responses, these findings have important implications for creating approaches to 
control Thl immune responses and Thl mediated-autoimmune diseases using agents such 
as cyclooxygenase inhibitors and selective prostaglandin receptor agonist or antagonists. 






71 



Prostaglandin receptor agonists that mediate a desired response such as decreasing 
secretion of IL-12p70 (e.g. butaprost) could result in desired cellular responses without 
unwanted affects. Given the results of this study, timing the application of these agents 
(e.g. early, when MDC are immature or maturing, and/or using agents such as anti-CD40 
antibody to block maturation) may be critical for reducing IL-12 production. Further 
study is needed, however, in order to determine the effects of EP agonists or Cox-2 
inhibitors alone or in combination with others to modify immune responses in the desired 



manner. 



CHAPTER 5 

GENERATION OF PHENOTYPICALLY AND FUNCTIONALLY NORMAL 

MONOCYTE DERIVED DENDRITIC CELLS FROM SUBJECTS AT HIGH RISK 

FOR AUTOIMMUNE INSULIN DEPENDENT DIABETES 



Review of Literature 

Autoimmune insulin dependent diabetes (IDD) results from a cell mediated 
response that destroys the insulin producing cells of the pancreas. Although T cells are 
critical to the pathogenesis of IDD, macrophages (MO) and dendritic cells (DC), 
professional antigen presenting cells (APC), are major contributors because the initiation 
of the autoimmune process begins with the presentation of P cell specific antigens to 
autoreactive CD4+ T cells as well as the important role of DC in tolerance. Defects in 
the stimulatory capacity of APC may promote autoimmune disease by deficient 
generation of regulatory cells or by impaired antigen presentation that leads to 
accumulation of autoreactive T cells. 

Recently, Litherland et al. (1999) reported that freshly isolated monocytes from 
subjects at high risk for IDD aberrantly express cyclooxygenase-2 (COX-2 or 
prostaglandin synthase-2, PGS-2). This abnormal expression results in high levels of 
prostaglandin E2 (PGE2) (Litherland et al, 1999). Prostaglandins, especially PGE2, 
have diverse effects on the immune response. PGE2 modulate T cell activation by down 
regulation of IL-2 production and expression of CD25 (a chain, high affinity IL-2 
receptor) while promoting Th2 associated cytokines IL-4 and IL-5 (Betz and Fox, 1991; 
Katamura et al, 1995). Additionally, PGE2 down regulates IL-12p70 production but 

72 



73 

increases the immunostimulatory capacity of DC further modulating the response. In 
1997, Kalinski et al. (1997) reported that exogenous PGE2 added to cultures of 
monocytes differentiating into DC affected the ability of the monocyte derived dendritic 
cell (MDC) to express CD la and secrete IL-12 (Kalinski et al, 1997). Additionally, 
Jansen et al. (1995) found that MDC from subjects with clinical IDD had reduced 
clustering with autologous and allogeneic T cells as well as reduced activation of 
autologous and allogeneic mixed lymphocyte reaction (MLR). Takahasi, Honeyman, and 
Harrison (1998) reported that MDC from subjects at high risk for IDD had reduced 
expression of co-stimulatory molecules, CD80 and CD86, and impaired antigen 
presentation as measured by autologous and allogeneic MLR (Takahashi et al, 1998). 
Because of the aberrant expression of COX-2 in peripheral blood monocytes of 
subjects at risk for IDD, the publish abnormalities in clustering and T cell activation of 
MDC in subjects with IDD, and the affects of PGE2 on MDC differentiation, this study 
was designed to answer the question, does abnormal COX-2 expression in subjects at risk 
for IDD impair MDC differentiation? Additionally, this study expands on previously 
published data by examining the surface marker expression, antigen uptake, cytokine 
production and activation of T cells by immature MDC (I-MDC) as well as MDC 
matured with TNF-oc or soluble trimeric CD40L (sCD40L) in subjects at high risk for 
IDD compared to normal health controls. Using an established method for differentiating 
DC from monocytes (Sallusto and Lanzavecchia, 1994), this study shows in vitro 
generation of phenotypically and functionally normal MDC from subjects at high risk for 
IDD when compared to normal controls. These results may have important clinical 
relevance in recently proposed immunotherapy or vaccination for prevention of diabetes. 



74 

Materials and Methods 
Subjects 

Heparinized whole blood was collected from informed consented subjects (IRB 
#372-96) participating in the University of Florida subcutaneous Insulin Diabetes 
Prevention Trial (SQ), the Natural History of Diabetes Trial (NH) and the Diabetes 
Prevention Trial (DPT). Because each study had different criteria for entry, subjects 
were assigned risk based on the results of islet cell antibody (ICA), glutamic acid 
decarboxylase antibody (GAD), insulin antibody (IAA), results of first phase insulin 
response (FPIR) to intravenous glucose tolerance test (IVGTT), and genetic screening for 
the protective HLA allele DQ0602. Subjects confirmed positive for ICA and an 
abnormal (low) FPIR are designated high risk (HR) while subjects with a positive ICA 
and IAA with a normal FPIR are moderate risk (MR). Subjects with positive ICA, 
negative IAA and a normal FPIR are considered low risk (LR). Subjects positive for 
protective allele DQ0602 or who are repeat negative for ICA are not eligible and 
considered not at risk (NR). Heparinized whole blood from normal healthly controls was 
collected on the same days as blood from the subjects. Some normal control had a family 
history of autoimmune disease but either tested negative for ICA or had the protective 
allele DQ0602 and are considered NR. 
Isolation of Monocyte and MDC Culture Conditions 

Peripheral blood mononuclear cells (PBMC) were isolated from heparized whole 
blood from subjects and controls using Histopaque Ficoll (Sigma, 1.077, endotoxin 
tested, St. Louis, MO). Cells were washed two times with Dulbecco's PBS (DPBS), Ca^ 
and Mg^ free (Cellgro, endotoxin tested) and resuspended in RPMI 1640 media with L- 



75 

glutamine (Gibco, BRL, Grand Island, NY) supplemented with 10% fetal calf serum 
(Hyclone, endotoxin tested, Logan, UT), and 1% streptomycin, penicillin, neomycin 
(Sigma). PBMC were allowed to adhere for 2 hours at 37°C, 5% C0 2 , 100% humidity 
and non-adherent cells were washed away with DPBS. Complete RPMI tested negative 
for endotoxin (<2.0 EU/ml) (E-Toxate® Kit, Sigma). Adherent cells were cultured for 6 
days in complete RPMI supplement with 500 U (50 ng/ml) GM-CSF (Endogen, Woburn, 
MA) and 500-1000 U IL-4 (R&D Systems, Minneapolis, MN) to generate I-MDC 
(Sallusto and Lanzavecchia, 1994). To generate M-MDC, day 6 I-MDC were harvested, 
washed and re-plated at 3.0 X 10 5 cells/ml and supplemented with 50 ng/ml of human 
recombinant TNF-a (Endogen) or 1 ug/ml sCD40L (gift from Immunex, Seattle WA). 
Some cultures were supplemented with 5 uM NS-398 (Cayman Chemical, Ann Arbor, 
MI), a specific COX-2 inhibitor . 
Flow Cytometry for Surface and Internal Proteins 

The following monoclonal antibodies directed against surface or internal proteins 
were used: CD 14, HLA-DR (clone L243, Becton-Dickinson, San Jose, CA or clone 
TU36, Pharmingen, San Diego, CA), CD la, CD86, CD80, CD40 (Pharmingen), CD83 
(Coulter-Immunotech, Miami, FL), and COX-2 (Cayman Chemical). Appropriate 
fluorochrome labeled isotype control antibodies were used. Cells were suspended in PBS 
with 1% BSA (reagent grade, Sigma) and 0.1% Sodium Azide (Sigma). For surface 
marker labeling, cells were incubated with 1 \xg of fluorochrome conjugated antibody/1 X 
10 6 cells for 20 minutes at room temperature, then washed one time with 2.0 ml of PBS 
and resuspended in 500 ul of 1% formaldehyde in PBS. Intracellular labeling of COX-2 



76 

was performed as previously described (Litherland et ah, 1999). All cells were analyzed 

on Becton-Dickinson FACSCalibur or FACSort. 

Autologous and Allogeneic Mixed Lymphocyte Reaction (MLR) 

MDC were washed and replated at various concentrations in 96- well plates. 
Autologous or allogeneic nylon wool purified T cells were added at 1.5 X 10 5 cells/well. 
Each condition was performed in triplicate. Proliferation was measure on day 5 by a 1 6- 
hour pulse with [3H] Thymidine (1 uCi/well, Amersham Life Sciences, Arlington 
Heights, IL). Some autologous MLR were supplemented with GAD, tetanus or insulin 
peptide to measure specific T cell responses. 
Measurement of I L- 12 and Prostanoids 

Supernatants from cultures of MDC were harvested for analysis of PGE2 and IL- 
12. 1-MDC were cultured for 6 days, washed from the plate, counted and re-plated at 3 X 
1 5 cells/ml in media containing GM-CSF and IL-4. I-MDC were cultured for an 
additional 48 hours before supernatants were harvested for analysis. Supernatants from 
maturing M-MDC, were prepared by harvesting I-MDC on day 6, re-plating these cells at 
the same density in media containing GM-CSF, IL-4 and maturation stimuli. Cells were 
cultured for an additional 48 hours and then supernatants harvested. MDC culture 
supernatants from various conditions were analyzed for IL-12p70 and IL-12p40 (gift 
from Dr. Maurice Gately, Hoffrnan Roche, Nutely, NJ), by ELISA in duplicate as 
previously described (Zhang et ah, 1 994). The lower limit of IL- 1 2p40 and IL- 1 2p70 
detection in this assay is 1 5.6 pg/ml. PGE2 and thromboxane were measured by 
competitive enzyme immunoassay (Cayman Chemical). IL-12, PGE2 and thromboxane 
values were standardized to pg/ml/ 1 X 10 6 cells. 



77 

Measurement of Endocytosis 

Mannose receptor-mediated endocytosis was measure by the cellular uptake of 
FITC-Dextran ( FD, 40,000 MW, Molecular Probes, Eugene, OR) and quantitated by 
flow cytometry (Sallusto et al., 1995). Approximately 1.5 X 10 5 MDC were incubated 
in complete RPMI with 25 raM Hepes and 1 mg/ml of FITC-Detran for 1 hour at °C 
and 37°C. After 1 hour, cells were washed 4 times with ice-cold IX PBS with 0.1% 
Sodium Azide and immediately tested on the flow cytometer (Becton-Dickinson 
FACSCalibur, San Jose, CA). Fluid-phase endocytosis by macropinocytosis was 
measured by cellular uptake exactly as described for uptake of FD except 1 mg/ml 
Lucifer Yellow (LY, dipotassium salt, Molecular Probes) was used. Mean fluorescent 
intensity (MFI) of 37°C - 0°C was used to evaluate antigen uptake during different 
maturation states of MDC. 
Statistical Analysis 

Surface marker expression data were statistically evaluated by analysis of 
variance with log transformation. All other data were evaluated using two-tailed 
Student's t test or pair t test as indicated in the table legends. Level of statistical 
significance was set at p < 0.05. 

Results 

Table 5-1 details the demographics of the study set including the sex, age (mean 
and range) and risk of normal controls and subjects with risk for IDD. Table 5-2 shows 
the statistical summary for the surface markers used to distinguish DC in I-MDC and 
table 5-3 shows the summary for I-MDC matured for 48 hours with sCD40L, a in vitro T 
cell mimick. No statistical difference was noted for percent of cells positive (I-MDC 



78 

















•B 












a> 





"fr 








• S 






*0 






Q 






V3 












• ^ 


















ad 





0\ 


.2 






S 




<u 












■*-j 












B 






od 




u"> 









£ 







c 











"O 










0) 






od 





r^ 


co 






J 


m 


X) 












M 




< 


* 


, 




CO 

X 




2 


Z 


m 


* - ' 
















ja 






II 






C3 


ON 


rt- 


K 






s 




^3- 


CO 










D. 




00 


PL, 


1— i 




•a 

u 

■♦-» 

2 


i 




a> 
1 







£ 


a, 

1 

(4-1 





s 


£ 




A 


u 

< 







ON 


2 

CO 


09 










* 


O 










3 




00 

1 


vo 


r- 


S «5 

II "g 


§> 




& 


(N 


"O 


* ^ 







c3 






J J2 


£ 




&o 






is 


u 










-* — 


Q 










5 § 


~ 


-g 


_H 


VO 


C3 CO 




z 



H 


m 


00 


c g 








m 


-52 


gs 














7^ C 








O 




< .3 






U 


C/5 





79 



Table 5-2: Phenotypic marker expression in I-MDC from normal controls and 
subjects at risk for IDD. 



Variable 


n 


Control 


Subject 


P A 


CD1a percent 


24 


82.8 


70.5 


0.1334 


CD14 percent 


24 


14.1 


13.5 


0.8561 


CD40 percent 


14 


95.5 


92.2 


0.2332 


CD80 percent 


16 


49.0 


36.3 


0.4538 


CD83 percent 


8 


5.4 


3.6 


0.7342 


CD86 percent 


16 


44.9 


45.3 


0.6903 


HLA-DR surface percent 


26 


91.7 


86.5 


0.3842 


COX-2 percent 


16 


63.8 


51.5 


0.4016 




CDIaMFI 


24 


118.0 


106.0 


0.7419 


CD14MFI 


24 


24.0 


23.0 


0.9718 


CD40 MFI 


14 


68.8 


55.6 


0.6313 


CD80 MFI 


16 


26.1 


24.3 


0.7755 


CD83 MFI 


8 


4.7 


7.8 


0.2571 


CD86 MFI 


16 


45.1 


45.5 


0.9165 


HLA-DR surface MFI 


26 


178.9 


258.6 


0.6899 


COX-2 MFI 


16 


29.9 


28.8 


0.9595 



A No statistically significant differences were noted between the 
two groups measured by the analysis of variance with log 
transformation. 



80 

only) or mean fluorescence intensity (MFI) as measured by flow cytometry and analyzed 
by analysis of variance with log transformation. Because of the small study size, 
statistical analysis between risk groups was not possible. 

Because of the importance of MHC molecules in T cells activation and the 
reported association of HLA haplotypes and IDD, surface and total HLA-DR for I-MDC 
and I-MDC matured with TNF-a for 48 hours in the absence and absence of NS398 are 
shown in Table 5-3. Initially, a difference was noted in the MFI of total HLA-DR for 
TNF-a stimulated I-MDC (in the presence and absence of NS398) using the Tu36 
antibody. This difference could not be substantiated with a different HLA-DR clone, 
L243. Both clones of antibody are documented to bind to the non-polymorphic region of 
the a and P chains of human HLA-DR. HLA-DR is a known risk factor for IDD. It is 
possible that the Tu36 antibody does not bind as well as L243 to HLA-DR molecules 
associated with risk to IDD. The HLA-DR types for participants of the DPT are not 
known; therefore, preferential binding to specific HLA molecules could not be 
investigated at this time. 

High levels of PGE2 (lO^M) inhibit the ability of the MDC to secrete IL-12. This 
study evaluated the spontaneous production of PGE2 in I-MDC and the secretion of IL- 
12 in I-MDC and I-MDC matured with TNF-a of subjects at high risk for IDD and 
normal controls. The results are summarized in Table 5-5. The ability to uptake antigen 
by receptor-mediated mechanisms by I-MDC as well as the ability to shut down the 
antigen uptake machinery in M-MDC was investigated. No differences noted in I-MDC 
or M-MDC (Table 5-6). Finally, MDC from subjects at risk for IDD and normal controls 



81 



Table 5-3: Phenotypic marker expression in M-MDC matured with sCD40L 
from normal controls and subjects at risk for IDD. 



Variable 


1 

n 


Control 


Subject 


P" 


CDIaMFI 


8 


48.1 


26.8 


0.16 


CD80 MFI 


8 


49.4 


41.1 


0.48 


CD83 MFI 


8 


146.2 


157.4 


0.82 


CD86 MFI 


8 


681.3 


600.5 


0.63 


HLA-DR surface MFI 


8 


2141.2 


2064.0 


0.97 



A No statistically significant differences were noted between 
the two groups measured by the analysis of variance with 
log transformation. 



82 



Table 5-4: Mean Fluorescent Intensity comparisons of Surface and 
Total HLA-DR in I-MDC and I-MDC stimulated with TNF-a normal 
controls and subjects at risk for IDD. 







L243 








Tu36 










n Control 


subjects p f 


n 


Control 


Subjects p + 


I-MDC 


Surface 


10 237.2 


257.6 


0.7522 


14 


49.4 


32.3 


0.4216 


I-MDC 


Total 


10 912.2 


1042.2 


0.7007 


14 


181.1 


923 


01148 


I-MDC/NS 


Surface 


10 269.0 


257.0 


0.9155 


14 


33.1 


333 


0.9906 


I-MDC/NS 


Total 


10 818.2 


941.8 


0.5736 


14 


125.3 


71.9 


0.1394 


I-MDC+TNF 


Surface 


12 671.5 


904.5 


0.1740 


18 


78.8 


432 


0.1068 


I-MDC+TNF 


Total 


12 2211.0 


1739.5 


0.3771 


18 


423.4 


169.6 


0.0151* 


I-MDC+TNF/NS Surface 


10 657.6 


775.2 


0.5473 


14 


93.5 


47.1 


0.0932 


I-MDC +TNF/NS Total 


10 2096.2 


1683.4 


0.3933 


14 


339.1 


137.4 


0.0124* 



L243 and Tu36 are two different clones of monoclonal antibody to 
human HLA-DR. * Total HLA-DR shows statistically significant 
differences with Tu36 clone in I-MDC stimulated with TNF-a with 
and without NS398, a specific COX-2 inhibitor, but no differences 
were found with L243. * Student's t test (two tailed) used for 
statistical analysis with p<0.05 as level of significance. 



83 



Table 5-5: IL-12 and PGE2 production in MDC from normal controls 
and subjects at risk for IDD. 



Variable 


MDC Type 


n Controls Subjects pt 


IL-12 


I-MDC 


23 4873.6 3101.4 0.4304 


IL-12 


II-MDC + TNF 


19 6661.6 9463.6 0.4673 


PGE2 


I-MDC 


17 1670.8 1485.1 0.8534 



* Differences in mean values were compared 
by Student's t test 



84 



Table 5-6: Comparison of receptor mediated antigen uptake in MDC 
from normal controls and subjects at risk for IDD. 



MDC 


n 


Controls 


Subjects 


Pt 


I-MDC 


19 


396.2 


466.1 


0.6979 


M-MDC 


19 


50.6 


123.4 


0.1544 



Antigen uptake measured by FITC-Dextran (mean 
MFI). tStudent's t test (two tailed) used for 
statistical analysis. 



Table 5-7: Mixed Lymphocyte Reaction in normal controls and subjects 
at risk for IDD. 





Alb 


Auto GAD 


Insulin 


Tetanus 




n 


8 


8 7 


7 7 


Controls 


mean 


2.74 


4.17 


1.34 


1.21 


1.13 










Subjects mean 


3.62 


3.60 0.91 


0.83 


0.89 










p# 


0.28 


0.84 0.20 


0.08 0.23 



85 



Alio = allogeneic, Auto = autologous mean index shown. Index is 
calculated by 3 H thymidine incorportation of MLR divided by 3 H 
thymidine incorportation of T cells alone. GAD = glutamic acid 
decarboxylase, index for GAD, insulin, and tetanus is 3 H thymidine 
incorportion in antigen specific MLR divided by 3 H thymidine 
incorportation of autologous MLR. #Indices were compared by the 
Student's t test (two tailed) with p<0.05 as level of significance. 



86 

were compared in the ability to activate T cells in autologous, allogeneic, and peptide 
specific mixed lymphocyte reactions. Table 5-7 summarizes the findings. 

Discussion 

Although previous investigators have reported differences in the expression of 
costimulatory molecules, CD80 and CD86 (Takahashi et al., 1998) and stimulatory 
capacity in autologous and allogeneic MLR (Jansen et al, 1995; Takahashi et al, 1998), 
this study finds no phenotypical or functional differences in monocyte derived dendritic 
cells for the studies performed between subjects at high, moderate or low risk for 
developing diabetes and controls that are at no risk. Several differences between the 
previous reported findings and this study exist which may account for differences in 
findings. First, the quantity of GM-CSF and IL-4 used in the Takahasi, Honeyman, and 
Harrison (1998) study was 400 U/ml of IL-4 while this study used 500-1000 U/ml. 
Shuler et al. (1999) reports that <200 U/ml of IL-4 give variable generation of MDC from 
monocytes whereas >200 U/ml of IL-4 was adequate for differentiation except in an 
occasional donor and 1000 U/ml of IL-4 always was successful in generation of MDC 
from monocytes (Shuler et al, 1999). These results suggest that the level of IL-4 used in 
this study (>500 U/ml) may be artificially high when compared to physiological levels 
and the results noted between this study and the Takahashi, Honeyman, and Harrison 
study (1998) may explain the differences in the MDC generation. Additional studies 
employing varying quantities of IL-4 may be helpful in sorting out the inconsistencies. 

Although the method described in this study yielded phenotypically and 
functionally "normal" MDC, it is possible that generation of MDC in vivo may be 
defective in subjects at high risk for autoimmune diseases such as IDD. Recently, a 



87 

subset of circulating, mature T cells expressing an invariant TCR a chain, referred to as 
NK T cells or NK1.1 in mice, were shown to be able to produce large quantities of IL-4 
or IFN-y rapidly upon interaction with CD Id molecules on dendritic cells, and may be 
major source of these cytokines during an immune response (Chen and Paul, 1997). 
Additionally, one study suggests that mice that are deficient in NK T cells naturally or by 
selective reduction are prone to autoimmunity (Mieza et al., 1996). One study in 
humans, also, reports deficiency of NK T cells in humans with IDD (Wilson et al, 
1998). Therefore, the possibility exist that subjects at high risk for IDD may indeed have 
defects in differentiation or generation of MDC which were overcome as a result of the 
culture conditions used (high levels of IL-4). 

The ability to generate "normal" MDC from subjects at high risk for IDD may 
have distinct advantages in using MDC as immunotherapy for prevention of IDD. The 
ability of producing large quantities of immature DC from monocytes has led to many 
studies proposing the use of dendritic cells as therapeutic agents in the treatment of 
tumors, allograft tolerance, and autoimmunity. The ability to generate phenotypically 
and functionally normal responding MDC from subjects at high risk for IDD may provide 
a therapeutic mechanism for induction of islet cell tolerance. Indeed, adoptive transfer 
studies of matured myeloid DC from the pancreatic draining lymph node of NOD mice 
into young NOD resulted in transfer of protection from diabetes and tolerance to p cell 
antigens (Clare-Salzler et al, 1992). Additionally, Shinomiya et al. (1999) showed that 
DC from the spleens of non-diabetic female NOD mice matured in the presence of IFN-y 
prevented diabetes by an unknown mechanism. They suggest that the age of the recipient 
and route of entry of DC are important for the anti-diabetogenic capacity of the tolerizing 



88 

effect (Shinomiya et al, 1999). Others have suggested that genetically engineered DC 
such as DC that express immunosuppressive agents such as IL-10 or TGF-P may induce a 
Th2 response or anergy. Alternatively, DC that express pro-apoptotic molecules such 
FASL may induce activation induced cell death (Lu et al, 1999). 

This study shows that regardless of in vivo defects associated with inability to 
activate T cells, generation of phenotypically and functionally normal MDC can be 
achieved using standard techniques. These ex vivo derived MDC may provide a 
mechanism for induction of tolerance against p cell antigen or other autoantigens; 
however, the mechanism of induction of tolerance needs to be elucidated. 



CHAPTER 6 
SUMMARY AND CONCLUSIONS 



This study has examined the role of prostaglandins, especially PGE2, in the 
maturation and function of MDC. Dendritic cells are the most potent antigen presenting 
cells and are unique in their ability to activate naive T cells. Because of their critical role 
in the adaptive immune response, their use in immunotherapy for treatment of tumors, 
transplantation, vaccines and autoimmunity have been proposed. Understanding agents 
that modify DC which subsequently alter the T cell activation process may provide 
means to manipulate DC in vitro to achieve desired response in vivo. 

Chapter 3 describes the constitutive expression of COX-2 in MDC and the 
production of prostaglandins that autoregulate their maturation and secretion of IL-12, a 
critical proinflammatory cytokine. Endogenously produced MDC prostaglandins do not 
contribute to the differentiation of MDC from monocytes as measured by standard 
surface marker expression (e.g., CDla, CD14, CD40, CD80, CD83, CD86 and HLA-DR) 
but do contribute to the expression of CD83, a mature DC specific marker, in MDC 
matured with sCD40L and IFN-y. The secretion of IL-12 in I-MDC and M-MDC is 
regulated by endogenously produced prostaglandins; however, the effect is opposed. 
Immature DC that only produced IL-12p40 decrease secretion in response to blocking 
endogenous prostaglandins while M-MDC that produce IL-12p40 and IL-12p70 increase 
secretion of both forms when COX-2 mediated prostaglandins are inhibited. These 



89 



90 

results provided the basis for examination of prostaglandin receptors as a mechanism for 
divergent regulation of IL-12 secretion in I- and M-MDC. 

Chapter 4 focuses on the role of prostaglandin receptors as mediators of IL-12 
regulation in I-MDC and M-MDC. This study examines EP1, EP2, EP3 and EP4 in I- 
MDC, maturing and fully matured MDC by competitive RT-PCR, 3 H-PGE displacement 
with EP specific agonists, and measurement of IL-12p40 and p70 after exposure to 
receptor specific agonists. I-MDC predominantly express EP2 and EP4 receptors and 
when stimulated with EP2/EP4 agonists or cAMP analogues increased IL-12p40 two- 
fold. In the presence of CD40L/IFN-y, the maturing MDC produces IL-12p70 and p40 
that are completely suppressed by EP2 agonists and cAMP analogues. During MDC 
maturation, EP2 mRNA gradually declines by 50% over 24 hours while EP4 mRNA 
increases rapidly by two-fold at 4 hours and remains increase after 48 hours. After 48 
hours of stimulation, MDC are fully mature and express 30% fewer prostaglandin 
receptors and EP4 is dominantly expressed. Despite expressing EP receptors, IL-12p70 
production by fully mature MDC is completely insensitive to PGE2 as well as forskolin 
or cAMP analogues. These studies demonstrate three diverse responses of MDC IL-12 
production, corresponding to distinct maturation states and characterize the role of 
specific EP receptors in each response. It is apparent from these studies that EP2 and EP4 
receptors play a dominant role, however, the presence of the maturing stimulus reverses 
the effects of the EP2-mediated signal from stimulatory in I-MDC to suppressive in 
maturing MDC. These studies also demonstrate that full maturation alters several 
components of the PGE2 signaling pathway such that MDC IL-12 production is well 
protected from prostaglandin-mediated suppression. 



91 

Finally, studies described in Chapter 5 compared MDC from subjects at high risk 
for IDD and normal controls. Previously described aberrant expression of COX-2 in 
monocytes from subjects at high risk for IDD and effects of PGE2 on MDC 
differentiation from monocytes, prompted this investigation. Although no significant 
differences were noted between subjects with high risk for IDD and normal controls with 
respect to typical DC surface marker expression, production of cytokines, antigen uptake 
and ability T cell activation, this study provides a springboard for future studies including 
the use of autologous MDC for induction of tolerance to p cell antigens in subjects at 

high risk for IDD. 

Several problems were encountered during these investigations. First, in any 
human based study, the person-to-person differences, whether it is number of molecules 
per cell of a specific cell surface marker or quantity of cytokine secreted, vary 
tremendously and make between groups comparisons hard to interpret. Because of the 
variability, sometimes displaying the data as "representation" instead of combining many 
experiments by calculating means and standard error better characterizes the observable 
result. Second, in the study comparing MDC from subjects at high risk for IDD and 
normal controls, the amount of sample received on each subject and control was limited; 
therefore, not every variable was tested on every subject or control. This resulted in a 
small sample size for each variable. The small number of subjects for each variable made 
stratification of risk groups (HR, MR, LR) impossible to analyze statistically with any 
power and, perhaps, gave inaccurate conclusions when risk groups were lumped together 
as "subjects". In retrospect, fewer variables and combination of risk group (for example, 



92 



NR with LR and MR with HR) may have increased the sample size for each group and 
provided enough numbers to stratify the analysis such that differences could be realized. 
There are three potential areas for future experiments involving comparisons of 
MDC from subject at risk for IDD and normal controls. (1) Differentiation of MDC 
using varying amounts of IL-4 to determine if a threshold for IL-4 is required for 
differentiation of MDC from monocytes. It is possible that monocytes from subjects 
require a higher units of activity of IL-4 that normal controls. This could explain 
differences in the results of this study and previous studies. (2) Ability of the MDC to 
shut down receptor mediated antigen capture machinery in MDC matured with TNF-oc. 
Although no statistically significant difference between normal controls and subjects at 
risk for IDD was noted in the uptake of antigen as measure by FITC-Dextran in I-MDC, 
the ability to shut down receptor mediated endocytosis in the M-MDC matured with 
TNF-ct approached statistically significance (p=0.1544) and with a larger number of 
samples and risk stratification, it may be possible to detect differences. (3) The 
differences detected in total HLA-DR, but not surface HLA-DR molecules, on MDC 
from subjects at high risk for IDD and normal controls when using one clone of 
monoclonal antibody, Tu36, but not clone L243, is intriguing and raises interesting 
questions about the structure of intracellular HLA-DR in subjects. One potential 
explanation that is easily answered is that Tu36 does not bind as well to intracellular 
DR03 or DR04, HLA types associated with risk for IDD, compared to L243. 
Intracellular HLA-DR of these HLA risk types compared to other HLA-DR types may 
provide resolution to this query. 



93 

Characterization of prostaglandin receptors on I-MDC and M-MDC is a novel 
discovery and opens many potential avenues of research. First, does the 
microenvironment modulate the expression of these receptors? In these studies only 
maturation stimuli was added to the cultures when expression of the receptors was 
investigated. Of interest, does the expression of prostaglandin receptor change when 
maturation or function modulators, such as IL-10 and TGF-p\ are added to the culture. 
Second, IFN-y is a potent activator of MDC. After encountering IFN-y is the MDC 
terminally differentiated? Does IFN-y "lock" the MDC into a Thl versus a Th2 inducing 
APC? Finally, previous studies suggest that differing numbers and subtypes of 
prostaglandin receptors on T cells or APC modulate the effects of PGE2 and may be a 
potential mechanism of skewing the T cell response toward Thl or Th2. Additionally, 
subjects at risk for IDD (and NOD mice) express COX-2 abnormally in monocytes (MO 
in NOD mice) and produce higher levels of PGE2 compared to normal controls (and 
control mice). Examination of prostaglandin receptors on activated T cells and APC from 
subjects with high risk for IDD (and NOD mice) compared to normal controls (and 
control mice) may provide differences in sensitivity to PGE2 and may provide better 
understanding of polarization of T cells toward Thl or Th2. 

In conclusion, these studies examine the role of prostaglandins in the maturation 
and function of MDC. Understanding the effects of micronenviromental factors, present 
during antigen capture and maturation that modulate MDC function, may provide new 
approaches to manipulate the MDC to 1) induce T cell activation for immunity against 
infectious agents or tolerance against self-peptides, 2) regulate T cell responses including 
polarization toward Thl or Th2, and 3) terminate immune responses. 



REFERENCES 



Abbas, A.K., Murphy, K.M. and Sher, A. (1996) Functional diversity of helper T 
lymphocytes. Nature, 383, 787-93. 

Anastassiou, E.D., Paliogianni, F., Balow, J.P., Yamada, H. and Boumpas, D.T. (1992) 
Prostaglandin E2 and other cyclic AMP-elevating agents modulate IL-2 and IL- 
2R alpha gene expression at multiple levels. J Immunol, 148, 2845-52. 

Appleby, S.B., Ristimaki, A., Neilson, K., Narko, K. and Hla, T. (1994) Structure of the 
human cyclo-oxygenase-2 gene. Biochem J, 302, 723-7. 

Banchereau, J. and Steinman, R.M. (1998) Dendritic cells and the control of immunity. 
Nature, 392, 245-52. 

Bancroft, A. J., Else, K.J., Sypek, J.P. and Grencis, R.K. (1997) Interleukin-12 promotes a 
chronic intestinal nematode infection. Eur J Immunol, 27, 866-70. 

Bastepe, M. and Ashby, B. (1999) Identification of a region of the C-terminal domain 
involved in short-term desensitization of the prostaglandin EP4 receptor. Br J 
Pharmacol, 126, 365-71. 

Bauman, G.P., Bartik, M.M., Brooks, W.H. and Roszman, T.L. (1994) Induction of 

cAMP-dependent protein kinase (PKA) activity in T cells after stimulation of the 
prostaglandin E2 or the beta-adrenergic receptors: relationship between PKA 
activity and inhibition of anti-CD3 monoclonal antibody-induced T cell 
proliferation. Cell Immunol, 158, 182-94. 

Betz, M. and Fox, B.S. (1991) Prostaglandin E2 inhibits production of Thl lymphokines 
but not of Th2 lymphokines. J Immunol, 146, 108-13. 

Blaschke, V., Jungermann, K. and Puschel, G.P. (1996) Exclusive expression of the Gs- 
linked prostaglandin E2 receptor subtype 4 mRNA in mononuclear Jurkat and 
KM-3 cells and coexpression of subtype 4 and 2 mRNA in U-937 cells. FEBS 
Lett, 394, 39-43. 



94 



95 

Bloom, D., Jabrane-Ferrat, N., Zeng, L., Wu, A., Li, L., Lo, D., Turck, C.W., An, S. and 
Goetzl, E.J. (1999) Prostaglandin E2 enhancement of interferon-gamma 
production by antigen-stimulated type 1 helper T cells. Cell Immunol, 194, 21-7. 

Boehme, S.A. and Lenardo, M.J. (1993) Ligand-induced apoptosis of mature T 

lymphocytes (propriocidal regulation) occurs at distinct stages of the cell cycle. 
Leukemia, 7 Suppl 2, S45-9. 

Bridgett, M., Cetkovic-Cvrlje, M., O'Rourke, R., Shi, Y., Narayanswami, S., Lambert, J., 
Ramiya, V., Baekkeskov, S. and Leiter, E.H. (1998) Differential protection in two 
transgenic lines of NOD/Lt mice hyperexpressing the autoantigen GAD65 in 
pancreatic beta-cells. Diabetes, 47, 1848-56. 

Brock, T.G., McNish, R.W., Coffey, M.J., Ojo, T.C., Phare, S.M. and Peters-Golden, M. 
(1996) Effects of granulocyte-macrophage colony-stimulating factor on 
eicosanoid production by mononuclear phagocytes. J Immunol, 156, 2522-7. 

Caux, C, Massacrier, C., Dezutter-Dambuyant, C., Vanbervhet, B., Jacquet, C., Schmitt, 
D. and Banchereau, J. (1995) Human dendritic Langerhans cells generated in vitro 
from CD34+ progenitors can prime naive CD4+ T cells and process soluble 
antigen. J Immunol, 155, 5427-35. 

Caux, C, Massacrier, C, Vanbervhet, B., Dubois, B., Durand, I., Cella, M., 

Lanzavecchia, A. and Banchereau, J. (1997) CD34+ hematopoietic progenitors 
from human cord blood differentiate along two independent dendritic cell 
pathways in response to granulocyte-macrophage colony-stimulating factor plus 
tumor necrosis factor alpha: II. Functional analysis. Blood, 90, 1458-70. 

Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A. and Alber, 
G. (1996) Ligation of CD40 on dendritic cells triggers production of high levels 
of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC 
activation. J Exp Med, 184, 747-52. 

Chen, H. and Paul, W.E. (1997) Cultured NK1.1+ CD4+ T cells produce large amounts 
of IL-4 and IFN-gamma upon activation by anti-CD3 or CD1. J Immunol, 159, 
2240-9. 

Chiang, N. and Tai, H.H. (1998) The role of N-glycosylation of human thromboxane A2 
receptor in ligand binding. Arch Biochem Biophys, 352, 207-13. 

Choung, J., Taylor, L., Thomas, K., Zhou, X., Kagan, H., Yang, X. and Polgar, P. (1998) 
Role of EP2 receptors and cAMP in prostaglandin E2 regulated expression of type 
I collagen alphal, lysyl oxidase, and cyclooxygenase-1 genes in human embryo 
lung fibroblasts. J Cell Biochem, 71, 254-63. 



96 



Clare-Salzler, M. and Mullen, Y. (1992) Marked dendritic cell-T cell cluster formation in 
the pancreatic lymph node of the non-obese diabetic mouse. Immunology, 76, 
478-84. 

Clare-Salzler, M.J., Brooks, J., Chai, A., Van Herle, K. and Anderson, C. (1992) 

Prevention of diabetes in nonobese diabetic mice by dendritic cell transfer. J Clin 
Invest, 90, 741-8. 

Critchfield, J.M. and Lenardo, M.J. (1995) Antigen-induced programmed T cell death as 
a new approach to immune therapy. Clin Immunol Immunopathol, 75, 13-9. 

Crofford, L.J. (1997) COX-1 and COX-2 tissue expression: implications and predictions. 
J Rheumatol, 24 Suppl 49, 15-9. 

Dahlen, E., Dawe, K., Ohlsson, L. and Hedlund, G. (1998) Dendritic cells and 

macrophages are the first and major producers of TNF-alpha in pancreatic islets in 
the nonobese diabetic mouse. J Immunol, 160, 3585-93. 

de Saint- Vis, B., Fugier-Vivier, I., Massacrier, C, Gaillard, C, Vanbervliet, B., Ait- 
Yahia, S., Banchereau, J., Liu, Y.J., Lebecque, S. and Caux, C. (1998) The 
cytokine profile expressed by human dendritic cells is dependent on cell subtype 
and mode of activation. J Immunol, 160, 1666-76. 

De Smedt, T., Van Mechelen, M., De Becker, G., Urbain, J., Leo, O. and Moser, M. 
(1997) Effect of interleukin-10 on dendritic cell maturation and function. Eur J 
Immunol, 27, 1229-35. 

Delaney, C.A., Pavlovic, D., Hoorens, A., Pipeleers, D.G. and Eizirik, D.L. (1997) 

Cytokines induce deoxyribonucleic acid strand breaks and apoptosis in human 
pancreatic islet cells. Endocrinology, 138, 2610-4. 

Endo, T., Ogushi, F. and Sone, S. (1996) LPS-dependent cyclooxygenase-2 induction in 
human monocytes is down- regulated by IL-13, but not by IFN-gamma. J 
Immunol, 156, 2240-6. 

Eriksen, E.F., Richelsen, B., Beck-Nielsen, H., Melsen, F., Nielsen, H.K. and Mosekilde, 
L. (1985) Prostaglandin E2 receptors on human peripheral blood monocytes. 
Scand J Immunol, 21, 167-72. 

Finkelman, F.D., Lees, A., Birnbaum, R., Gause, W.C. and Morris, S.C. (1996) Dendritic 
cells can present antigen in vivo in a tolerogenic or immunogenic fashion. J 
Immunol, 157, 1406-14. 

Futaki, N., Takahashi, S., Yokoyama, M., Arai, I., Higuchi, S. and Otomo, S. (1994) NS- 
398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H 
synthase/cyclooxygenase (COX-2) activity in vitro. Prostaglandins, 47, 55-9. 



97 



Ganapathy, V., Gurlo, T., Jarstadmarken, H.O. and von Grafenstein, H. (2000) 

Regulation of TCR-induced IFN-gamma release from islet-reactive non-obese 
diabetic CD8(+) T cells by prostaglandin E(2) receptor signaling. Int Immunol, 
12, 851-860. 

Gately, M.K., Chizzonite, R., Presky, D.H. (1999) Measurement of Human and Mouse 
Interleukin-12. Wiley, Inc. 

Geijtenbeek, T.B., Kwon, D.S., Torensma, R, van Vliet, S.J., van Duijnhoven, G.C., 
Middel, J., Cornelissen, I.L., Nottet, H.S., KewalRamani, V.N., Littman, D.R., 
Figdor, C.G. and van Kooyk, Y. (2000) DC-SIGN, a dendritic cell-specific HIV- 
1 -binding protein that enhances trans-infection of T cells [see comments]. Cell, 
100, 587-97. 

Gillessen, S., Carvajal, D., Ling, P., Podlaski, F.J., Stremlo, D.L., Familletti, P.C., 

Gubler, U., Presky, D.H., Stern, A.S. and Gately, M.K. (1995) Mouse interleukin- 
12 (IL-12) p40 homodimer: a potent IL-12 antagonist. Eur J Immunol, 25, 200-6. 

GoetzL E.J., An, S. and Smith, W.L. (1995a) Specificity of expression and effects of 

eicosanoid mediators in normal physiology and human diseases. Faseb J, 9, 1051- 
8. 

Goetzl, E.J., An, S. and Zeng, L. (1995b) Specific suppression by prostaglandin E2 of 
activation-induced apoptosis of human CD4+CD8+ T lymphoblasts. J Immunol, 
154, 1041-7. 

Hancock, W.W., Pleau, M.E. and Kobzik, L. (1988) Recombinant granulocyte- 
macrophage colony-stimulating factor down- regulates expression of IL-2 
receptor on human mononuclear phagocytes by induction of prostaglandin E. J 
Immunol, 140, 3021-5. 

Hart, P.H., Jones, C.A. and Finlay- Jones, J.J. (1995) Monocytes cultured in cytokine- 
defined environments differ from freshly isolated monocytes in their responses to 
IL-4 and IL-10. J Leukoc Biol, 57, 909-18. 

Heath, W.R, Kurts, C, Miller, J.F. and Carbone, F.R (1998) Cross-tolerance: a pathway 
for inducing tolerance to peripheral tissue antigens. J Exp Med, 187, 1549-53. 

Heitmeier, M.R., Scarim, A.L. and Corbett, J. A. (1997) Interferon-gamma increases the 
sensitivity of islets of Langerhans for inducible nitric-oxide synthase expression 
induced by interleukin 1. J Biol Chem, 272, 13697-704. 



98 



Herschman, H.R., Reddy, S.T. and Xie, W. (1997) Function and regulation of 
prostaglandin synthase-2. Adv Exp Med Biol, 407, 61-6. 

Hilkens, C, Snijders, A., Vermeulen, H., van der Meide, P., Wierenga, E. and 

Kapsenberg, M. (1996) Accessory cell-derived interleukin-12 and prostaglandin 
E2 determine the level of interferon-gamma produced by activated human CD4+ 
T cells. Ann N YAcadSci, 795, 349-50. 

Hilkens, CM., Kalinski, P., de Boer, M. and Kapsenberg, M.L. (1997) Human dendritic 
cells require exogenous interleukin-12-inducing factors to direct the development 
of naive T-helper cells toward the Thl phenotype. Blood, 90, 1920-6. 

Hwang, D., Jang, B.C., Yu, G. and Boudreau, M. (1997) Expression of mitogen-inducible 
cyclooxygenase induced by lipopolysaccharide: mediation through both mitogen- 
activated protein kinase and NF-kappaB signaling pathways in macrophages. 
Biochem Pharmacol, 54, 87-96. 

Inaba, K., Turley, S., Yamaide, F., Iyoda, T., Mahnke, K., Inaba, ML, Pack, M., 

Subklewe, M., Sauter, B., ShefiF, D., Albert, M., Bhardwaj, N., Mellman, I. and 
Steinman, R.M. (1998) Efficient presentation of phagocytosed cellular fragments 
on the major histocompatibility complex class II products of dendritic cells. J Exp 
Med, 188, 2163-73. 

Jansen, A, van Hagen, M. and Drexhage, H.A. (1995) Defective maturation and function 
of antigen-presenting cells in type 1 diabetes. Lancet, 345, 491-2. 

Jonuleit, H., Kuhn, U., Muller, G., Steinbrink, K., Paragnik, L., Schmitt, E., Knop, J. and 
Enk, A.H. (1997) Pro-inflammatory cytokines and prostaglandins induce 
maturation of potent immunostimulatory dendritic cells under fetal calf serum- 
free conditions. Eur J Immunol, 27, 3135-42. 

Kalinski, P., Hilkens, CM., Snijders, A., Snijdewint, F.G. and Kapsenberg, M.L. (1997) 
IL-12-deficient dendritic cells, generated in the presence of prostaglandin E2, 
promote type 2 cytokine production in maturing human naive T helper cells. J 
Immunol, 159, 28-35. 

Kalinski, P., Hilkens, CM., Wierenga, E.A. and Kapsenberg, M.L. (1999a) T-cell 
priming by type-1 and type-2 polarized dendritic cells: the concept of a third 
signal. Immunol Today, 20, 561-7. 

Kalinski, P., Schuitemaker, J.H., Hilkens, CM. and Kapsenberg, M.L. (1998) 

Prostaglandin E2 induces the final maturation of IL-12-deficient CDla+CD83+ 
dendritic cells: the levels of IL-12 are determined during the final dendritic cell 
maturation and are resistant to further modulation. J Immunol, 161, 2804-9. 



99 



Kalinski, P., Schuitemaker, J.H., Hilkens, CM., Wierenga, E.A. and Kapsenberg, M.L. 
(1999b) Final maturation of dendritic cells is associated with impaired 
responsiveness to IFN-gamma and to bacterial IL-12 inducers: decreased ability 
of mature dendritic cells to produce IL-12 during the interaction with Th cells. J 
Immunol, 162, 3231-6. 

Karp, C.L. (1999) Measles: immunosuppression, interleukin-12, and complement 
receptors. Immunol Rev, 168, 91-101. 

Katamura, K., Shintaku, N., Yamauchi, Y., Fukui, T., Ohshima, Y., Mayumi, M. and 
Furusho, K. (1995) Prostaglandin E2 at priming of naive CD4+ T cells inhibits 
acquisition of ability to produce IFN-gamma and IL-2, but not IL-4 and IL-5. J 
Immunol, 155, 4604-12. 

Kaufman, D.L., Clare-Salzler, M., Tian, J., Forsthuber, T., Ting, G.S., Robinson, P., 
Atkinson, M.A., Sercarz, E.E., Tobin, A. J. and Lehmann, P.V. (1993) 
Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine 
insulin-dependent diabetes. Nature, 366, 69-72. 

Kiriyama, M., Ushikubi, F., Kobayashi, T., Hirata, M., Sugimoto, Y. and Narumiya, S. 
(1997) Ligand binding specificities of the eight types and subtypes of the mouse 
prostanoid receptors expressed in Chinese hamster ovary cells. Br J Pharmacol, 
122, 217-24. 

Kirk, A.D., Harlan, D.M., Armstrong, N.N., Davis, T.A., Dong, Y., Gray, G.S., Hong, X., 
Thomas, D., Fechner, J.H., Jr. and Knechtle, S.J. (1997) CTLA4-Ig and anti- 
CD40 ligand prevent renal allograft rejection in primates. Proc Natl Acad Sci US 
A, 94, 8789-94. 

Kirtikara, K., Morham, S.G., Raghow, R., Laulederkind, S.J., Kanekura, T., Goorha, S. 
and Ballou, L.R. (1998) Compensatory prostaglandin E2 biosynthesis in 
cyclooxygenase 1 or 2 null cells. J Exp Med, 187, 517-23. 

Kujubu, D.A. and Herschman, H.R. (1992) Dexamethasone inhibits mitogen induction of 
the TIS10 prostaglandin synthase/cyclooxygenase gene. J Biol Chem, 267, 7991- 
4. 

Kuroda, E., Sugiura, T., Zeki, K., Yoshida, Y. and Yamashita, U. (2000) Sensitivity 

difference to the suppressive effect of prostaglandin E2 among mouse strains: a 
possible mechanism to polarize Th2 type response in BALB/c mice. J Immunol, 
164, 2386-95. 



100 



Larsen, C.P., Elwood, E.T., Alexander, D.Z., Ritchie, S.C., Hendrix, R., Tucker-Burden, 
C, Cho, H.R., Aruffo, A., Hollenbaugh, D., Linsley, P.S., Winn, K.J. and 
Pearson, T.C. (1996) Long-term acceptance of skin and cardiac allografts after 
blocking CD40 and CD28 pathways. Nature, 381, 434-8. 

Leppert, D., Hauser, S.L., Kishiyama, J.L., An, S., Zeng, L. and Goetzl, E.J. (1995) 
Stimulation of matrix metalloproteinase-dependent migration of T cells by 
eicosanoids. Faseb J, 9, 1473-81. 

Ling, P., Gately, M.K., Gubler, U., Stern, A.S., Lin, P., Hollfelder, K., Su, C, Pan, Y.C. 
and Hakimi, J. (1995) Human IL-12 p40 homodimer binds to the IL-12 receptor 
but does not mediate biologic activity. J Immunol, 154, 1 16-27. 

Litherland, S.A., Xie, X.T., Hutson, A.D., WasserfalL C, Whittaker, D.S., She, J., Hofig, 
A., Dennis, M.A., Fuller, K., Cook, R., Schatz, D., Moldawer, L.L. and Clare- 
Salzler, M.J. (1999) Aberrant prostaglandin synthase 2 expression defines an 
antigen- presenting cell defect for insulin-dependent diabetes mellitus. J Clin 
Invest, 104, 515-23. 

Lu, L.K., S.J., Sayegh, M.H., Thomson, A.W. (1999) Dendritic cell tolerogenicity and 

prospects for dendritic cell-based therapy of allograft and autoimmunity. In Lotze, 
M.T., Thomsom A.W. (ed.) Dendritic Cells Biology and Clinical Applications. 
Academic Press, San Diego, pp. 487-51 1. 

Macatonia, S.E., Hosken, N.A., Litton, M., Vieira, P., Hsieh, C.S., Culpepper, J.A., 
Wysocka, M., Trinchieri, G., Murphy, K.M. and O'Garra, A. (1995) Dendritic 
cells produce IL-12 and direct the development of Thl cells from naive CD4+ T 
cells. J Immunol, 154, 5071-9. 

Maloney, C.G., Kutchera, W.A., Albertine, K.H., Mclntyre, T.M., Prescott, S.M. and 
Zimmerman, G.A. (1998) Inflammatory agonists induce cyclooxygenase type 2 
expression by human neutrophils. J Immunol, 160, 1402-10. 

Marshall, J.D., Chehimi, J., Gri, G., Kostman, J.R., Montaner, L.J. and Trinchieri, G. 
(1999) The interleukin-12-mediated pathway of immune events is dysfunctional 
in human immunodeficiency virus-infected individuals [see comments]. Blood, 
94,1003-11. 

Masferrer, J.L., Reddy, ST., Zweifel, B.S., Seibert, K., Needleman, P., Gilbert, R.S. and 
Herschman, H.R. (1994) In vivo glucocorticoids regulate cyclooxygenase-2 but 
not cyclooxygenase- 1 in peritoneal macrophages. J Pharmacol Exp Ther, 270, 
1340-4. 

Mattner, F., Fischer, S., Guckes, S., Jin, S., Kaulen, H., Schmitt, E., Rude, E. and 

Germann, T. (1993) The interleukin-12 subunit p40 specifically inhibits effects of 
the interleukin-12 heterodimer. Eur J Immunol, 23, 2202-8. 






101 



Meja, K.K., Barnes, P.J. and Giembycz, M.A. (1997) Characterization of the prostanoid 
receptor(s) on human blood monocytes at which prostaglandin E2 inhibits 
lipopolysaccharide-induced tumour necrosis factor-alpha generation. Br J 
Pharmacol, 111, 149-57. 

Mieza, M.A., Itoh, T., Cui, J.Q., Makino, Y., Kawano, T., Tsuchida, K., Koike, T., Shirai, 
T., Yagita, H., Matsuzawa, A., Koseki, H. and Taniguchi, M. (1996) Selective 
reduction of V alpha 14+ NK T cells associated with disease development in 
autoimmune-prone mice. J Immunol, 156, 4035-40. 

Mori, K., Tanaka, I., Kotani, M, Miyaoka, F., Sando, T., Muro, S., Sasaki, Y., 

Nakagawa, O., Ogawa, Y., Usui, T., Ozaki, S., Ichikawa, A, Narumiya, S. and 
Nakao, K. (1996) Gene expression of the human prostaglandin E receptor EP4 
subtype: differential regulation in monocytoid and lymphoid lineage cells by 
phorbol ester. J Mol Med, 74, 333-6. 

Morita, I., Schindler, M., Regier, M.K., Otto, J.C., Hori, T., DeWitt, D.L. and Smith, 
W.L. (1995) Different intracellular locations for prostaglandin endoperoxide H 
synthase- 1 and -2. J Biol Chem, 270, 10902-8. 

Mukhopadhyay, P., Bhattacherjee, P., Andom, T., Geoghegan, T.E., Andley, U.P. and 
Paterson, C.A. (1999) Expression of prostaglandin receptors EP4 and FP in 
human lens epithelial cells. Invest Ophthalmol Vis Sci, 40, 105-12. 

Murakami, M., Matsumoto, R., Austen, K.F. and Arm, J.P. (1994) Prostaglandin 

endoperoxide synthase- 1 and -2 couple to different transmembrane stimuli to 
generate prostaglandin D2 in mouse bone marrow-derived mast cells. J Biol 
Chem, 269, 22269-75. 

Narumiya, S., Sugimoto, Y. and Ushikubi, F. (1999) Prostanoid receptors: structures, 
properties, and functions. Physiol Rev, 79, 1 193-226. 

Nassar, G.M., Morrow, J.D., Roberts, L.J.d., Lakkis, F.G. and Badr, K.F. (1994) 

Induction of 15 -lipoxygenase by interleukin-13 in human blood monocytes. J Biol 
Chem, 269, 27631-4. 

Negishi, M., Sugimoto, Y. and Ichikawa, A. (1995) Molecular mechanisms of diverse 
actions of prostanoid receptors. Biochim Biophys Acta, 1259, 109-19. 

Niiro, H., Otsuka, T., Tanabe, T., Hara, S., Kuga, S., Nemoto, Y., Tanaka, Y., 

Nakashima, H., Kitajima, S., Abe, M. and et al. (1995) Inhibition by interleukin- 
10 of inducible cyclooxygenase expression in lipopolysaccharide-stimulated 



102 



monocytes: its underlying mechanism in comparison with interleukin-4. Blood, 
85, 3736-45. 

Nishigaki, N., Chang, C, Ichikawa, A. and Negishi, M. (1998) Cytoskeletal regulation of 
the signal transduction of prostaglandin EP4 receptor. Biochim Biophys Acta, 
1391,110-6. 

Palucka, K.A., Taquet, N., Sanchez-Chapuis, F. and Gluckman, J.C. (1998) Dendritic 

cells as the terminal stage of monocyte differentiation. J Immunol, 160, 4587-95. 

Piomelli, D. (1993) Arachidonic acid in cell signaling. Curr Opin Cell Biol, 5, 274-80. 

Reddy, A., Sapp, M., Feldman, M., Subklewe, M. and Bhardwaj, N. (1997a) A monocyte 
conditioned medium is more effective than defined cytokines in mediating the 
terminal maturation of human dendritic cells. Blood, 90, 3640-6. 

Reddy, ST., Winstead, M.V., Tischfield, J A. and Herschman, H.R. (1997b) Analysis of 
the secretory phospholipase A2 that mediates prostaglandin production in mast 
cells. J Biol Chem, 272, 13591-6. 

Rieser, C, Bock, G., Klocker, H., Bartsch, G. and Thurnher, M. (1997) Prostaglandin E2 
and tumor necrosis factor alpha cooperate to activate human dendritic cells: 
synergistic activation of interleukin 12 production. J Exp Med, 186, 1603-8. 

Romani, N., Gruner, S., Brang, D., Kampgen, E., Lenz, A., Trockenbacher, B., 
Konwalinka, G., Fritsch, P.O., Steinman, R.M. and Schuler, G. (1994) 
Proliferating dendritic cell progenitors in human blood. J Exp Med, 180, 83-93. 

Ronchese, F., Hausmann, B. and Le Gros, G. (1994) Interferon-gamma- and interleukin- 
4-producing T cells can be primed on dendritic cells in vivo and do not require the 
presence of B cells. Eur J Immunol, 24, 1 148-54. 

Rothe, H., O'Hara, R.M., Jr., Martin, S. and Kolb, H. (1997) Suppression of 

cyclophosphamide induced diabetes development and pancreatic Thl reactivity in 
NOD mice treated with the interleukin (IL)-12 antagonist IL-12(p40)2. 
Diabetologia, 40, 641-6. 

Sallusto, F., Cella, M, Danieli, C. and Lanzavecchia, A. (1995) Dendritic cells use 

macropinocytosis and the mannose receptor to concentrate macromolecules in the 
major histocompatibility complex class II compartment: downregulation by 
cytokines and bacterial products [see comments]. J Exp Med, 182, 389-400. 

Sallusto, F. and Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by 

cultured human dendritic cells is maintained by granulocyte/macrophage colony- 
stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor 
alpha. J Exp Med, 179, 1 109-18. 



103 



Scharton-Kersten, T., Afonso, L.C., Wysocka, M., Trinchieri, G. and Scott, P. (1995) IL- 
12 is required for natural killer cell activation and subsequent T helper 1 cell 
development in experimental leishmaniasis. J Immunol, 154, 5320-30. 

Seibert, K., Zhang, Y., Leahy, K., Hauser, S., Masferrer, J., Perkins, W., Lee, L. and 

Isakson, P. (1994) Pharmacological and biochemical demonstration of the role of 
cyclooxygenase 2 in inflammation and pain. Proc Natl Acad Sci USA, 91, 
12013-7. 

Serreze, D.V., Gaskins, H.R. and Leiter, E.H. (1993) Defects in the differentiation and 
function of antigen presenting cells in NOD/Lt mice. J Immunol, 150, 2534-43. 

Shinomiya, M., Fazle Akbar, S.M., Shinomiya, H. and Onji, M. (1999) Transfer of 
dendritic cells (DC) ex vivo stimulated with interferon-gamma (IFN-gamma) 
down-modulates autoimmune diabetes in non-obese diabetic (NOD) mice. Clin 
Exp Immunol, 117, 38-43. 

Shortman, K. and Caux, C. (1997) Dendritic cell development: multiple pathways to 
nature's adjuvants. Stem Cells, 15, 409-19. 

Shortman, K., Wu, L., Suss, G., Kronin, V., Winkel, K., Saunders, D. and Vremec, D. 
(1997) Dendritic cells and T lymphocytes: developmental and functional 
interactions. Ciba Found Symp, 204, 130-8. 

Shu, U., Kiniwa, M., Wu, C.Y., Maliszewski, C., Vezzio, N., Hakimi, J., Gately, M. and 
Delespesse, G. (1995) Activated T cells induce interleukin-12 production by 
monocytes via CD40-CD40 ligand interaction. Eur J Immunol, 25, 1 125-8. 

Shuler, G., Lutz, M., Bender, A., Thurner, B., Roder, C, Young, J.W. and Romani, N. 
(1999) A guide to the isolation and propagation of dendritic cells. In Lotze, M.T. 
and Thomson, A.W. (eds.), Dendritic Cells. Academic Press, San Diego, pp. 251- 
256. 

Smit, M.J., Verzijl, D. and Iyengar, R. (1998) Identity of adenylyl cyclase isoform 

determines the rate of cell cycle progression in NIH 3T3 cells. Proc Natl Acad Sci 
USA, 95, 15084-9. 

Smith, W.L., Garavito, R.M. and DeWitt, D.L. (1996) Prostaglandin endoperoxide H 
synthases (cyclooxygenases)-l and -2. J Biol Chem, 271, 33157-60. 

Snijders, A., Hilkens, CM., van der Pouw Kraan, T.C., Engel, M., Aarden, 

L.A. and Kapsenberg, M.L. (1996) Regulation of bioactive IL-12 production in 
lipopolysaccharide- stimulated human monocytes is determined by the expression 
ofthep35 subunit. J Immunol, 156, 1207-12. 



104 



Snijders, A., Kalinski, P., Hilkens, CM. and Kapsenberg, M.L. (1998) High-level IL-12 
production by human dendritic cells requires two signals, lnt Immunol, 10, 1593- 
8. 

Snijdewint, F.G., Kalinski, P., Wierenga, E.A., Bos, J.D. and Kapsenberg, M.L. (1993) 
Prostaglandin E2 differentially modulates cytokine secretion profiles of human T 
helper lymphocytes. J Immunol, 150, 5321-9. 

Steinman, R.M. (1991) The dendritic cell system and its role in immunogenicity. Annu 
Rev Immunol, 9, 271-96. 

Steinman, R.M., Pack, M. and Inaba, K. (1997a) Dendritic cell development and 
maturation. Adv Exp Med Biol, 417, 1-6. 

Steinman, R.M., Pack, M. and Inaba, K. (1997b) Dendritic cells in the T-cell areas of 
lymphoid organs. Immunol Rev, 156, 25-37. 

Strassmann, G., Patil-Koota, V., Finkelman, F., Fong, M. and Kambayashi, T. (1994) 
Evidence for the involvement of interleukin 10 in the differential deactivation of 
murine peritoneal macrophages by prostaglandin E2. J Exp Med, 180, 2365-70. 

Stumbles, P.A., Thomas, J.A., Pimm, C.L., Lee, P.T., Venaille, T.J., Proksch, S. and 

Holt, P.G. (1998) Resting respiratory tract dendritic cells preferentially stimulate 
T helper cell type 2 (Th2) responses and require obligatory cytokine signals for 
induction of Thl immunity. J Exp Med, 188, 2019-31. 

Suss, G. and Shortman, K. (1996) A subclass of dendritic cells kills CD4 T cells via 
Fas/Fas-ligand- induced apoptosis. J Exp Med, 183, 1789-96. 

Sutterwala, F.S. and Mosser, D.M. (1999) The taming of IL-12: suppressing the 
production of proinflammatory cytokines. JLeukoc Biol, 65, 543-51. 

Sutterwala, F.S., Noel, G.J., Clynes, R. and Mosser, D.M. (1997) Selective suppression 
of interleukin- 12 induction after macrophage receptor ligation. J Exp Med, 185, 
1977-85. 

Takahashi, K., Honeyman, M.C. and Harrison, L.C. (1998) Impaired yield, phenotype, 
and function of monocyte-derived dendritic cells in humans at risk for insulin- 
dependent diabetes. J Immunol, 161, 2629-35. 

Trembleau, S., Germann, T., Gately, M.K. and Adorini, L. (1995) The role of IL-12 in 
the induction of organ-specific autoimmune diseases. Immunol Today, 16, 383-6. 

Trembleau, S., Penna, G., Gregori, S., Chapman, H.D., Serreze, D.V., Magram, J. and 
Adorini, L. (1999) Pancreas-infiltrating Thl cells and diabetes develop in IL-12- 
deficient nonobese diabetic mice. J Immunol, 163, 2960-8. 



105 



Trinchieri, G. (1997) Function and clinical use of interleukin-12. Curr Opin Hematol, 4, 
59-66. 

Trinchieri, G. and Gerosa, F. (1996) Immunoregulation by interleukin-12. J Leukoc Biol, 
59,505-11. 

van der Pouw Kraan, T.C., Boeije, L.C., Smeenk, R.J., Wijdenes, J. and Aarden, L.A. 

(1995) Prostaglandin^ is a potent inhibitor of human interleukin 12 production. 
J Exp Med, 181,775-9. 

van der Pouw Kraan, T.C., Boeije, L.C., Snijders, A., Smeenk, R.J., Wijdenes, J. and 

Aarden, L.A. (1996) Regulation of IL-12 production by human monocytes and the 
influence of prostaglandin E2. Ann N YAcadSci, 795, 147-57. 

Visnjic, D., Batinic, D. and Banfic, H. (1997) Arachidonic acid mediates interferon- 
gamma-induced sphingomyelin hydrolysis and monocytic marker expression in 
HL-60 cell line. Blood, 89, 81-91. 

Weissman, D., Daucher, J., Barker, T., Adelsberger, J., Baseler, M. and Fauci, A.S. 

(1996) Cytokine regulation of HIV replication induced by dendritic cell-CD4- 
positive T cell interactions. AIDS Res Hum Retroviruses, 12, 759-67. 

Williams, J. A. and Shacter, E. (1997) Regulation of macrophage cytokine production by 
prostaglandin E2. Distinct roles of cyclooxygenase-1 and -2. J Biol Chem, 272, 
25693-9. 

Wilson, S.B., Kent, S.C., Patton, K.T., Orban, T., Jackson, R.A., Exley, M., Porcelli, S., 
Schatz, D.A., Atkinson, M.A., Balk, S.P., Strominger, J.L. and Hafler, D.A. 
(1998) Extreme Thl bias of invariant Valpha24JalphaQ T cells in type 1 diabetes 
[published erratum appears in Nature 1999 May 6;399(6731):84]. Nature, 391, 
177-81. 

Xie, T. (1997) The role of prostagladin synthase 2 (PGS2) in the immunopathogenesis of 
NOD diabetes. Pathology. University of Florida, Gainesville, p. 127. 

Yamaoka, K., Otsuka, T., Niiro, H., Arinobu, Y., Niho, Y., Hamasaki, N. and Izuhara, K. 
(1998) Activation of STAT5 by lipopolysaccharide through granulocyte- 
macrophage colony-stimulating factor production in human monocytes. J 
Immunol, 160, 838-45. 

Yoshimoto, T., Wang, C.R, Yoneto, T., Waki, S., Sunaga, S., Komagata, Y., Mitsuyama, 
M., Miyazaki, J. and Nariuchi, H. (1998) Reduced T helper 1 responses in IL-12 
p40 transgenic mice. J Immunol, 160, 588-94. 



106 



Zeng, L., An, S. and Goetzl, E.J. (1998) EP4/EP2 receptor-specific prostaglandin E2 
regulation of interleukin-6 generation by human HSB.2 early T cells. J 
Pharmacol Exp Ther, 286, 1420-6. 

Zhang, M., Gately, M.K., Wang, E., Gong, J., Wolf, S.F., Lu, S., Modlin, R.L. and 
Barnes, P.F. (1994) Interleukin 12 at the site of disease in tuberculosis. J Clin 
Invest, 93, 1733-9. 

Zhou, L.J. and Tedder, T.F. (1995) Human blood dendritic cells selectively express 

CD83, a member of the immunoglobulin superfamily. J Immunol, 154, 3821-35. 

Zhou, L.J. and Tedder, T.F. (1996) CD 14+ blood monocytes can differentiate into 

functionally mature CD83+ dendritic cells. Proc Natl Acad Sci USA, 93, 2588- 
92. 



BIOGRAPHICAL SKETCH 

Donna S. Whittaker is a Major in the United States Army Medical Service Corps. 
She received her Bachelor's of Science in medical technology from the Medical College of 
Georgia in 1983 and a Master's in Health Science in transfusion medicine from Duke 
University in 1994. Major Whittaker is an American Society of Clinical Pathology 
certified Medical Technologist and Specialist in Blood Banking. She has over fifteen years 
experience in managing clinical laboratories. In 1990, Major Whittaker served as the 
laboratory officer for the 47 th Combat Support Hospital during operation Desert Shield 
and Desert Storm. For her meritorious contributions during this conflict she was awarded 
the Bronze Star. Major Whittaker is married to Thomas Harpole Steves and has two 
children, Garrett and Trevor Whittaker. She is an avid runner and enjoys collecting 
stamps. After receiving her doctoral degree, she will serve as the Director, Donor and 
Transfusion Services, Brooke Army Medical Center, Fort Sam Houston, Texas. 



107 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 

ri 





Michael J. Clare^Salzler, Chair 
Associate Professor of Pathology, 
Immunology, and Laboratory Medicine 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 



iHd^i 



Maureen MrtjooHenow 

Professor of Pathology, Immunology, and 

Laboratory Medicine 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy.^ J I 

fhu~— 



Lyle L. Moldawer 
Professor of Surgery 

I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 



2 




■~fi*'*}YvZXZi 



AmmpjuBr4*eck 

Professor of Pathology, Immunology, and 
Laboratory Medicine 

I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 



^M^t4a^/- LO^dl^u 



Margaret R. Wallace 

Associate Professor of Biochemistry and 

Molecular Biology 



This dissertation was submitted to the Graduate Faculty of the College of 
Medicine and to the Graduate School and was accepted as partial fulfillment of the 
requirements for the degree of Doctor of Philosophy. 



August 2000 



Dean, College of Medicine 




Dean, Graduate School